siRNA Database

This database is NOT complete and is compiled ONLY from published siRNAs--it should only be considered a 'draft' of what such a database could be! To be really effective, this type of database would best be maintained full time, be complete, and have search capability--I do not have time for this! I expect that such a database will eventually become available, as large scale RNAi projects begin publishing siRNA and hairpin sequences, along with phenotypes of knockouts etc. (similar to what is done with Wormbase). This page is provided only as a courtesy; please check the validity of each sequence in the respective paper. Maybe it helps....

comments? Michael McManus.
gene geneID siRNA strand reference
AhR NM_001621 1416 - 1434 Mol Pharmacol 2003 Jun;63(6):1373-81
Aryl Hydrocarbon Receptor Gene Silencing with Small Inhibitory RNA Differentially Modulates Ah-Responsiveness in MCF-7 and HepG2 Cancer Cells.
Abdelrahim M, Smith R 3rd, Safe S.
ARNT Mol Pharmacol 2003 Jun;63(6):1373-81
Aryl Hydrocarbon Receptor Gene Silencing with Small Inhibitory RNA Differentially Modulates Ah-Responsiveness in MCF-7 and HepG2 Cancer Cells.
Abdelrahim M, Smith R 3rd, Safe S.
Prnp NM_011170 GCCCAGCAAACCAAAAACC-dTdT J Cell Sci 2003 May 20
Specific inhibition of pathological prion protein accumulation by small interfering RNAs.
Daude N, Marella M, Chabry J.
eRF1 ggagaucuggaagaucaagTT
guugaucuuccagaucuccTT		 RNA 2003 Jun;9(6):648-653
Stop codon suppression via inhibition of eRF1 expression.
Carnes J, Jacobson M, Leinwand L, Yarus M.
eRF1 uggcaccagcaugauaucaTT
ugauaucaugcuggugccaTT		 RNA 2003 Jun;9(6):648-653
Stop codon suppression via inhibition of eRF1 expression.
Carnes J, Jacobson M, Leinwand L, Yarus M.
eRF1 cacaagaagggucucaguuTT
aacugagacccuucuugugTT		 RNA 2003 Jun;9(6):648-653
Stop codon suppression via inhibition of eRF1 expression.
Carnes J, Jacobson M, Leinwand L, Yarus M.
MAPK14 BT006933

CCTACAGAGAACTGCGGTT-dTdT

ATGTGATTGGTCTGTTGGA-dTdT

TTCTCCGAGGTCTAAAGTA-dTdT

TAATTCACAGGGACCTAAA-dTdT

CCAGTGGCCGATCCTTATG-dTdT

TGCCTACTTTGCTCAGTAC-dTdT

GTCATCAGCTTTGTGCCAC-dTdT

Nat Biotechnol 2003 May 18
Expression profiling reveals off-target gene regulation by RNAi.
Jackson AL, Bartz SR, Schelter J, Kobayashi SV, Burchard J, Mao M, Li B, Cavet G, Linsley PS.

 
IGF1R NM_000875 GCTCACGGTCATTACCGAG-dTdT Nat Biotechnol 2003 May 18
Expression profiling reveals off-target gene regulation by RNAi.
Jackson AL, Bartz SR, Schelter J, Kobayashi SV, Burchard J, Mao M, Li B, Cavet G, Linsley PS.
HBV cauuguucaccucaccauaTT
uauggugaggugaacaaugTT		 FEBS Lett 2003 May 22;543(1-3):51-4
Short interfering RNA-directed inhibition of hepatitis B virus replication.
Hamasaki K, Nakao K, Matsumoto K, Ichikawa T, Ishikawa H, Eguchi K.
GFP ggcuacguccaggagcgcacc
ugcgcuccuggacguagccTT		 FEBS Lett 2003 May 22;543(1-3):51-4
Short interfering RNA-directed inhibition of hepatitis B virus replication.
Hamasaki K, Nakao K, Matsumoto K, Ichikawa T, Ishikawa H, Eguchi K.
GTSE   J Biol Chem 2003 May 15
The cell-cycle regulated protein human GTSE-1 controls DNA-damage induced apoptosis by affecting p53 function.
Monte M, Benetti R, Buscemi G, Sandy P, Del Sal G, Schneider C.
Chk1 Proc Natl Acad Sci U S A 2003 May 13
Specificity of short interfering RNA determined through gene expression signatures.
Semizarov D, Frost L, Sarthy A, Kroeger P, Halbert DN, Fesik SW.
AKT1 NM_005163 CGTGAGGCTCCCCTCAACA-dTdT Proc Natl Acad Sci U S A 2003 May 13
Specificity of short interfering RNA determined through gene expression signatures.
Semizarov D, Frost L, Sarthy A, Kroeger P, Halbert DN, Fesik SW.
Rb Proc Natl Acad Sci U S A 2003 May 13
Specificity of short interfering RNA determined through gene expression signatures.
Semizarov D, Frost L, Sarthy A, Kroeger P, Halbert DN, Fesik SW.
Plk1 NM_005030 CCAGTGGTTCGAGAGACAG-dTdT Proc Natl Acad Sci U S A 2003 May 13
Specificity of short interfering RNA determined through gene expression signatures.
Semizarov D, Frost L, Sarthy A, Kroeger P, Halbert DN, Fesik SW.
FADD aatgcgttctccttctctgtgcctgtc J Biol Chem 2003 May 12
cFLIP-L inhibits p38 MAPK activation: An additional anti-apoptotic mechanism in bile acid-mediated apoptosis.
Grambihler A, Higuchi H, Bronk SF, Gores GJ.
AR ccacaaauaccuggcuauaTT EMBO J 2003 May 15;22(10):2411-2421
TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells.
Gschwind A, Hart S, Fischer OM, Ullrich A.
AR aaauccauguaaugcagaaTT EMBO J 2003 May 15;22(10):2411-2421
TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells.
Gschwind A, Hart S, Fischer OM, Ullrich A.
HB-EGF gugaaguugggcaugacuaTT EMBO J 2003 May 15;22(10):2411-2421
TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells.
Gschwind A, Hart S, Fischer OM, Ullrich A.
HB-EGF uacaaggacuucugcauccTT EMBO J 2003 May 15;22(10):2411-2421
TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells.
Gschwind A, Hart S, Fischer OM, Ullrich A.
TGFÉø aacacugugaguggugccgTT EMBO J 2003 May 15;22(10):2411-2421
TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells.
Gschwind A, Hart S, Fischer OM, Ullrich A.
TGFÉø gaagcaggccaucaccgccTT EMBO J 2003 May 15;22(10):2411-2421
TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells.
Gschwind A, Hart S, Fischer OM, Ullrich A.
TACE aguuugcuuggcacaccuuTT EMBO J 2003 May 15;22(10):2411-2421
TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells.
Gschwind A, Hart S, Fischer OM, Ullrich A.
TACE aguaaggcccaggaguguuTT EMBO J 2003 May 15;22(10):2411-2421
TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells.
Gschwind A, Hart S, Fischer OM, Ullrich A.
TACE cauagagccacuuuggagaTT EMBO J 2003 May 15;22(10):2411-2421
TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells.
Gschwind A, Hart S, Fischer OM, Ullrich A.
ADAM12 ccucgcugcaaagaaugugTT EMBO J 2003 May 15;22(10):2411-2421
TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells.
Gschwind A, Hart S, Fischer OM, Ullrich A.
ADAM12 cguacgcggaauacuucgaTT EMBO J 2003 May 15;22(10):2411-2421
TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells.
Gschwind A, Hart S, Fischer OM, Ullrich A.
human HCF-1 aaggagctcatcgtggtgttt EMBO J 2003 May 15;22(10):2360-9
Proteolytic processing is necessary to separate and ensure proper cell growth and cytokinesis functions of HCF-1.
Julien E, Herr W.
mouse HCF-1 aaggagcttatagtggtgttt EMBO J 2003 May 15;22(10):2360-9
Proteolytic processing is necessary to separate and ensure proper cell growth and cytokinesis functions of HCF-1.
Julien E, Herr W.
hamster HCF-1 aaggagctcatagtggtgttt EMBO J 2003 May 15;22(10):2360-9
Proteolytic processing is necessary to separate and ensure proper cell growth and cytokinesis functions of HCF-1.
Julien E, Herr W.
Akt1 ugcccuucuacaaccaggaTT
uccugguuguagaagggcaTT		 J Biol Chem 2003 May 6
Use of RNA-interference-mediated gene silencing and adenoviral overexpression to Elucidate the roles of AKT/PKB-isoforms in insulin actions.
Katome T, Obata T, Matsushima R, Masuyama N, Cantley LC, Gotoh Y, Kishi K, Shiota H, Ebina Y.
Akt2 acucuuccacaucugagauTT
aucucagauguggaagaguTT		 J Biol Chem 2003 May 6
Use of RNA-interference-mediated gene silencing and adenoviral overexpression to Elucidate the roles of AKT/PKB-isoforms in insulin actions.
Katome T, Obata T, Matsushima R, Masuyama N, Cantley LC, Gotoh Y, Kishi K, Shiota H, Ebina Y.
Akt3 auaauauuggagaggaagaTT
ucuuccucuccaauauuauTT		 J Biol Chem 2003 May 6
Use of RNA-interference-mediated gene silencing and adenoviral overexpression to Elucidate the roles of AKT/PKB-isoforms in insulin actions.
Katome T, Obata T, Matsushima R, Masuyama N, Cantley LC, Gotoh Y, Kishi K, Shiota H, Ebina Y.
GFP cuggaguugucccaauuccTT
agaauugggacaacuccagTT		 J Biol Chem 2003 May 6
Use of RNA-interference-mediated gene silencing and adenoviral overexpression to Elucidate the roles of AKT/PKB-isoforms in insulin actions.
Katome T, Obata T, Matsushima R, Masuyama N, Cantley LC, Gotoh Y, Kishi K, Shiota H, Ebina Y.
p73 Cancer Cell 2003 Apr;3(4):403-10
Chemosensitivity linked to p73 function.
Irwin MS, Kondo K, Marin MC, Cheng LS, Hahn WC, Kaelin WG.
TRPC1 X89066 AAGCTTTTCTTGCTGGCGTGC-dTdT Biochem J 2003 Apr 29
Evidence that TRPC1 forms a Ca 2+ permeable channel linked to the regulation of cell volume in liver cells obtained using siRNA targeted against TRPC1.
Chen J, Barritt GJ.
HDAC6 NM_006044 AAGACCTAATCGTGGGACTGC-dTdT Mol Cell 2003 Apr;11(4):1043-54
p300 Transcriptional Repression Is Mediated by SUMO Modification.
Girdwood D, Bumpass D, Vaughan OA, Thain A, Anderson LA, Snowden AW, Garcia-Wilson E, Perkins ND, Hay RT.
Y14 AF299118 AACGCTCTGTTGAAGGCTGGA-dT-dT Mol Cell 2003 Apr;11(4):939-49
Y14 and hUpf3b Form an NMD-Activating Complex.
Gehring NH, Neu-Yilik G, Schell T, Hentze MW, Kulozik AE.
CRIF1 aagaacgcgaatggtacccga J Biol Chem 2003 Apr 25
CR6 interacting factor 1 (CRIF1) interacts with Gadd45 family proteins and modulates the cell cycle.
Chung H, Yi YW, Jung NC, Kim D, Suh JM, Kim H, Park KC, Song JH, Kim DW, Hwang ES, Yoon SH, Bae YS, Kim JM, Bae I, Shong M.
CRIF1 aagatgccacagatgattgtg J Biol Chem 2003 Apr 25
CR6 interacting factor 1 (CRIF1) interacts with Gadd45 family proteins and modulates the cell cycle.
Chung H, Yi YW, Jung NC, Kim D, Suh JM, Kim H, Park KC, Song JH, Kim DW, Hwang ES, Yoon SH, Bae YS, Kim JM, Bae I, Shong M.
CRIF1 aagcgcctcaaggaggaaaaa J Biol Chem 2003 Apr 25
CR6 interacting factor 1 (CRIF1) interacts with Gadd45 family proteins and modulates the cell cycle.
Chung H, Yi YW, Jung NC, Kim D, Suh JM, Kim H, Park KC, Song JH, Kim DW, Hwang ES, Yoon SH, Bae YS, Kim JM, Bae I, Shong M.
CRIF1 aaaaacagaaacggaagaagg J Biol Chem 2003 Apr 25
CR6 interacting factor 1 (CRIF1) interacts with Gadd45 family proteins and modulates the cell cycle.
Chung H, Yi YW, Jung NC, Kim D, Suh JM, Kim H, Park KC, Song JH, Kim DW, Hwang ES, Yoon SH, Bae YS, Kim JM, Bae I, Shong M.
hDAB2 FEBS Lett 2003 Apr 24;541(1-3):21-7
Disabled-2 small interfering RNA modulates cellular adhesive function and MAPK activity during megakaryocytic differentiation of K562 cells.
Tseng CP, Huang CL, Huang CH, Cheng JC, Stern A, Tseng CH, Chiu DT.
RhoA aagaaaaagtccgggtgccttcctgtctc Dev Dyn 2003 May;227(1):35-47
RhoA is highly up-regulated in the process of early heart development of the chick and important for normal embryogenesis.
Kaarbo M, Crane DI, Murrell WG.
p27Kip1 aagtacgagtggcaagaggtg J Biol Chem 2003 Apr 16
The role of cyclin-dependent kinase inhibitor p27Kip1 in anti-HER2 antibody-induced G1 cell cycle arrest and tumor growth inhibition.
Le XF, Claret FX, Lammayot A, Tian L, Deshpande D, LaPushin R, Tari AM, Bast RC Jr.
p27Kip1 aagcactgcagagacatggaa J Biol Chem 2003 Apr 16
The role of cyclin-dependent kinase inhibitor p27Kip1 in anti-HER2 antibody-induced G1 cell cycle arrest and tumor growth inhibition.
Le XF, Claret FX, Lammayot A, Tian L, Deshpande D, LaPushin R, Tari AM, Bast RC Jr.
hILK   J Biol Chem 2003 Apr 8
Conditional knock-out of integrin-linked kinase (ILK) demonstrates an essential role in PKB/Akt activation.
Troussard AA, Mawji NN, Ong C, Mui A, St Arnaud R, Dedhar S.
beta-catenin agcugauauugauggacagTT Clin Cancer Res 2003 Apr;9(4):1291-300
Small Interfering RNAs Directed against beta-Catenin Inhibit the in Vitro and in Vivo Growth of Colon Cancer Cells.
Verma UN, Surabhi RM, Schmaltieg A, Becerra C, Gaynor RB.
beta-catenin caguugugguuaagcucuuAC Clin Cancer Res 2003 Apr;9(4):1291-300
Small Interfering RNAs Directed against beta-Catenin Inhibit the in Vitro and in Vivo Growth of Colon Cancer Cells.
Verma UN, Surabhi RM, Schmaltieg A, Becerra C, Gaynor RB.
APC gcaacagaagcagagagguTT Clin Cancer Res 2003 Apr;9(4):1291-300
Small Interfering RNAs Directed against beta-Catenin Inhibit the in Vitro and in Vivo Growth of Colon Cancer Cells.
Verma UN, Surabhi RM, Schmaltieg A, Becerra C, Gaynor RB.
NF-kappaB gcccuaucccuuuacgucaTT Clin Cancer Res 2003 Apr;9(4):1291-300
Small Interfering RNAs Directed against beta-Catenin Inhibit the in Vitro and in Vivo Growth of Colon Cancer Cells.
Verma UN, Surabhi RM, Schmaltieg A, Becerra C, Gaynor RB.
HTLV-1 Tax gauggacgcguuaucggcuTT Clin Cancer Res 2003 Apr;9(4):1291-300
Small Interfering RNAs Directed against beta-Catenin Inhibit the in Vitro and in Vivo Growth of Colon Cancer Cells.
Verma UN, Surabhi RM, Schmaltieg A, Becerra C, Gaynor RB.
murine RASA1 NM_002890 AAGATGAAGCCACTACCCTATTT-dTdT Nat Biotechnol 2003 Apr 7
Transgenic RNA interference in ES cell-derived embryos recapitulates a genetic null phenotype.
Kunath T, Gish G, Lickert H, Jones N, Pawson T, Rossant J.
hRASA1 Nat Biotechnol 2003 Apr 7
Transgenic RNA interference in ES cell-derived embryos recapitulates a genetic null phenotype.
Kunath T, Gish G, Lickert H, Jones N, Pawson T, Rossant J.
Chk1 aactgaagaagcagtcgcagt J Biol Chem 2003 Apr 3
Chk1 mediates S and G2 arrests through Cdc25Adegradation in response to DNA damaging agents.
Xiao Z, Chen Z, Gunasekera AH, Sowin TJ, Rosenberg SH, Fesik S, Zhang H.
Chk1 scramble aacaagtgaagcagtcgcagt J Biol Chem 2003 Apr 3
Chk1 mediates S and G2 arrests through Cdc25Adegradation in response to DNA damaging agents.
Xiao Z, Chen Z, Gunasekera AH, Sowin TJ, Rosenberg SH, Fesik S, Zhang H.
p120(ctn) Gastroenterology 2003 Apr;124(4):949-60
Up-regulation, nuclear import, and tumor growth stimulation of the adhesion protein p120 in pancreatic cancer.
Mayerle J, Friess H, Buchler MW, Schnekenburger J, Weiss FU, Zimmer KP, Domschke W, Lerch MM.
ATM TGTATCAGCCTCAACACAAGCCTCCAGGCAG-dTdT Cancer Res 2003 Apr 1;63(7):1550-4
Enhanced Radiation and Chemotherapy-mediated Cell Killing of Human Cancer Cells by Small Inhibitory RNA Silencing of DNA Repair Factors.
Collis SJ, Swartz MJ, Nelson WG, DeWeese TL.
ATR NM_001184 CCATGATCCCCGCCCTGCGGGAGCTGGGCAG-dTdT Cancer Res 2003 Apr 1;63(7):1550-4
Enhanced Radiation and Chemotherapy-mediated Cell Killing of Human Cancer Cells by Small Inhibitory RNA Silencing of DNA Repair Factors.
Collis SJ, Swartz MJ, Nelson WG, DeWeese TL.
DNA-PKcs Cancer Res 2003 Apr 1;63(7):1550-4
Enhanced Radiation and Chemotherapy-mediated Cell Killing of Human Cancer Cells by Small Inhibitory RNA Silencing of DNA Repair Factors.
Collis SJ, Swartz MJ, Nelson WG, DeWeese TL.
telomerase uugucuaacccuaacugagTT
cucaguuaggguuagacaaTT		 Mol Cancer Ther 2003 Mar;2(3):209-16
Inhibition of telomerase activity in human cancer cells by RNA interference.
Kosciolek BA, Kalantidis K, Tabler M, Rowley PT.
telomerase ggcuucuccggaggcacccTT
gggugccuccggagaagccTT		 Mol Cancer Ther 2003 Mar;2(3):209-16
Inhibition of telomerase activity in human cancer cells by RNA interference.
Kosciolek BA, Kalantidis K, Tabler M, Rowley PT.
hTERT caagguggaugugacgggcTT
gcccgucacauccacguugTT		 Mol Cancer Ther 2003 Mar;2(3):209-16
Inhibition of telomerase activity in human cancer cells by RNA interference.
Kosciolek BA, Kalantidis K, Tabler M, Rowley PT.
Chk1 gaagcagucgcagugaagaTT
ucuucacugcgacugguucTT		 J Biol Chem 2003 Mar 24
Questioning the role of Chk2 in the p53 DNA Damage Response.
Ahn J, Urist M, Prives C.
Chk2 gaaccugaggaccaagaac
guucuugguccucagguuc		 J Biol Chem 2003 Mar 24
Questioning the role of Chk2 in the p53 DNA Damage Response.
Ahn J, Urist M, Prives C.
TNF gugccuaugucucagccucuu Mol Biol 2003 Apr 4;327(4):761-6
Gene Silencing by Systemic Delivery of Synthetic siRNAs in Adult Mice.
Sorensen DR, Leirdal M, Sioud M.
TNF gaucaucuucucaaaauucuu Mol Biol 2003 Apr 4;327(4):761-6
Gene Silencing by Systemic Delivery of Synthetic siRNAs in Adult Mice.
Sorensen DR, Leirdal M, Sioud M.
TNF gacaaccaacuaguggugcuu Mol Biol 2003 Apr 4;327(4):761-6
Gene Silencing by Systemic Delivery of Synthetic siRNAs in Adult Mice.
Sorensen DR, Leirdal M, Sioud M.
TNF ggagaaagucaaccuccucuu Mol Biol 2003 Apr 4;327(4):761-6
Gene Silencing by Systemic Delivery of Synthetic siRNAs in Adult Mice.
Sorensen DR, Leirdal M, Sioud M.
TNF ggccuuccuaccuucagacuu Mol Biol 2003 Apr 4;327(4):761-6
Gene Silencing by Systemic Delivery of Synthetic siRNAs in Adult Mice.
Sorensen DR, Leirdal M, Sioud M.
cyclin G aagucaguugccaaugggacaTT Oncogene 2003 Mar 20;22(11):1678-87
Modulation of p53 and p73 levels by cyclin G: implication of a negative feedback regulation.
Ohtsuka T, Ryu H, Minamishima YA, Ryo A, Lee SW.
lamin A/C aactggacttccagaagaaca Proc Natl Acad Sci U S A 2003 Jan 7;100(1):235-40
Clearance of replicating hepatitis C virus replicon RNAs in cell culture by small interfering RNAs.
Randall G, Grakoui A, Rice CM.
HCV aacctcaaagaaaaaccaaac Proc Natl Acad Sci U S A 2003 Jan 7;100(1):235-40
Clearance of replicating hepatitis C virus replicon RNAs in cell culture by small interfering RNAs.
Randall G, Grakoui A, Rice CM.
HCV-Con1 aaggtgcttgtggatattttg Proc Natl Acad Sci U S A 2003 Jan 7;100(1):235-40
Clearance of replicating hepatitis C virus replicon RNAs in cell culture by small interfering RNAs.
Randall G, Grakoui A, Rice CM.
HCV-C/LB aaggcgcttgtggacattctg Proc Natl Acad Sci U S A 2003 Jan 7;100(1):235-40
Clearance of replicating hepatitis C virus replicon RNAs in cell culture by small interfering RNAs.
Randall G, Grakoui A, Rice CM.
GABP aaggatgctcgagactgtatt Biol Chem 2003 Mar 4
Purification and mass spectrometric identification of GABP as the functional pituitary Ets factor binding to the basal transcription element of the prolactin promoter.
Schweppe RE, Melton AA, Brodsky KS, Aveline LD, Resing KA, Ahn NG, Gutierrez-Hartmann A.
GABP aacatatggcaagccctcaat Biol Chem 2003 Mar 4
Purification and mass spectrometric identification of GABP as the functional pituitary Ets factor binding to the basal transcription element of the prolactin promoter.
Schweppe RE, Melton AA, Brodsky KS, Aveline LD, Resing KA, Ahn NG, Gutierrez-Hartmann A.
MDC1 gucucccagaagacagugaTT Nature 2003 Feb 27;421(6926):961-6
MDC1 is a mediator of the mammalian DNA damage checkpoint.
Stewart GS, Wang B, Bignell CR, Taylor AM, Elledge SJ.
MDC1 acaguuguccccacagcccTT Nature 2003 Feb 27;421(6926):961-6
MDC1 is a mediator of the mammalian DNA damage checkpoint.
Stewart GS, Wang B, Bignell CR, Taylor AM, Elledge SJ.
EMCV-IRES cgucuaggcccccgaaccacTT Proc Natl Acad Sci U S A 2003 Feb 19
RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells.
Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, Sarangi F, Harris-Brandts M, Beaulieu S, Richardson CD.
NS3 cucguccccuccggccguaccTT Proc Natl Acad Sci U S A 2003 Feb 19
RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells.
Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, Sarangi F, Harris-Brandts M, Beaulieu S, Richardson CD.
NS3 gggggggaggcaccucauuuuTT Proc Natl Acad Sci U S A 2003 Feb 19
RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells.
Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, Sarangi F, Harris-Brandts M, Beaulieu S, Richardson CD.
NS5b ggagaugaaggcgaaggcgucTT Proc Natl Acad Sci U S A 2003 Feb 19
RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells.
Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, Sarangi F, Harris-Brandts M, Beaulieu S, Richardson CD.
NS5b gacacugagacaccaauugacTT Proc Natl Acad Sci U S A 2003 Feb 19
RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells.
Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, Sarangi F, Harris-Brandts M, Beaulieu S, Richardson CD.
NS5b gggcagaacugcggcuaucgcTT Proc Natl Acad Sci U S A 2003 Feb 19
RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells.
Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, Sarangi F, Harris-Brandts M, Beaulieu S, Richardson CD.
influenza virus Proc Natl Acad Sci U S A 2003 Feb 19
RNA interference of influenza virus production by directly targeting mRNA for degradation and indirectly inhibiting all viral RNA transcription.
Ge Q, McManus MT, Nguyen T, Shen CH, Sharp PA, Eisen HN, Chen J.
GFP p-ggcuacguccaggagcgcaTT
p-ugcgcuccuggacguagccTT		 Nat Med 2003 Feb 10
RNA interference targeting Fas protects mice from fulminant hepatitis.
Song E, Lee SK, Wang J, Ince N, Ouyang N, Min J, Chen J, Shankar P, Lieberman J.
GFP p-ggcuacguccaggagcgcacc
p-ugcgcuccuggacguagccuu		 Nat Med 2003 Feb 10
RNA interference targeting Fas protects mice from fulminant hepatitis.
Song E, Lee SK, Wang J, Ince N, Ouyang N, Min J, Chen J, Shankar P, Lieberman J.
Fas p-aagccgaaugucgcagaacTT
p-guucugcgacauucggcuuTT		 Nat Med 2003 Feb 10
RNA interference targeting Fas protects mice from fulminant hepatitis.
Song E, Lee SK, Wang J, Ince N, Ouyang N, Min J, Chen J, Shankar P, Lieberman J.
Fas p-auacaucccgagaauugcuTT
p-agcaauucucgggauguauTT		 Nat Med 2003 Feb 10
RNA interference targeting Fas protects mice from fulminant hepatitis.
Song E, Lee SK, Wang J, Ince N, Ouyang N, Min J, Chen J, Shankar P, Lieberman J.
Fas p-aucgccuaugguuguugacTT
p-gucaacaaccauaggcgauTT		 Nat Med 2003 Feb 10
RNA interference targeting Fas protects mice from fulminant hepatitis.
Song E, Lee SK, Wang J, Ince N, Ouyang N, Min J, Chen J, Shankar P, Lieberman J.
Fas p-ggauuauaucaaggaggccTT
p-ggccuccuugauauaauccTT		 Nat Med 2003 Feb 10
RNA interference targeting Fas protects mice from fulminant hepatitis.
Song E, Lee SK, Wang J, Ince N, Ouyang N, Min J, Chen J, Shankar P, Lieberman J.
Fas p-agccgaaugucgcagaaccTT
p-gguucugcgacauucggcuTT		 Nat Med 2003 Feb 10
RNA interference targeting Fas protects mice from fulminant hepatitis.
Song E, Lee SK, Wang J, Ince N, Ouyang N, Min J, Chen J, Shankar P, Lieberman J.
Fas p-gugcaagugcaaaccagacTT
p-gucugguuugcacuugcacTT		 Nat Med 2003 Feb 10
RNA interference targeting Fas protects mice from fulminant hepatitis.
Song E, Lee SK, Wang J, Ince N, Ouyang N, Min J, Chen J, Shankar P, Lieberman J.
insulin recepter tataccatgaattccagcaacTT J Biol Chem 2003 Feb 3
Cdc42 is a Rho GTPase family member which can mediate insulin signaling to glucose transport in 3T3-L1 adipocytes.
Usui I, Imamura T, Huang J, Satoh H, Olefsky JM.
SMRT cgagaguucucgcuggacuTT J Biol Chem 2003 Feb 3
Cdc42 is a Rho GTPase family member which can mediate insulin signaling to glucose transport in 3T3-L1 adipocytes.
Usui I, Imamura T, Huang J, Satoh H, Olefsky JM.
cdc42 guuauccacagacagauguTT J Biol Chem 2003 Feb 3
Cdc42 is a Rho GTPase family member which can mediate insulin signaling to glucose transport in 3T3-L1 adipocytes.
Usui I, Imamura T, Huang J, Satoh H, Olefsky JM.
p75NTR AAGGAGACATGTTCCACAGGCAT-dtdT Biochem Biophys Res Commun 2003 Feb 14;301(3):804-9
Functional inhibition of the p75 receptor using a small interfering RNA.
Higuchi H, Yamashita T, Yoshikawa H, Tohyama M.
EGFP aagctgaccctgaagttcatc Biochem Biophys Res Commun 2003 Feb 14;301(3):704-10
Mammalian actin binding protein 1 is essential for endocytosis but not lamellipodia formation: functional analysis by RNA interference.
Mise-Omata S, Montagne B, Deckert M, Wienands J, Acuto O
hDok2 aaagaaatggcgccgcttcgg Biochem Biophys Res Commun 2003 Feb 14;301(3):704-10
Mammalian actin binding protein 1 is essential for endocytosis but not lamellipodia formation: functional analysis by RNA interference.
Mise-Omata S, Montagne B, Deckert M, Wienands J, Acuto O
hmAbp1 aagtccccgaccgactgggct Biochem Biophys Res Commun 2003 Feb 14;301(3):704-10
Mammalian actin binding protein 1 is essential for endocytosis but not lamellipodia formation: functional analysis by RNA interference.
Mise-Omata S, Montagne B, Deckert M, Wienands J, Acuto O.
mATM aaugucuuugaguaguaugTT
cauacuacucaaagacauuTT		 J Biol Chem 2003 Jan 21
Single-stranded DNA induces ATM/p53-dependent DNA damage and apoptotic signals.
Nur-E-Kamal A, Tsai-Kun L, Zhang A, Qi H, Hars E, Liu LF.
TonEBP J Am Soc Nephrol 2003 Feb;14(2):283-8
Silencing of TonEBP/NFAT5 transcriptional activator by RNA interference.
Na KY, Woo SK, Lee SD, Kwon HM.
hMLK3 aagaccctgaagatcaccgactt Mol Biol Cell 2003 Jan;14(1):156-72
A New Identity for MLK3 as an NIMA-related, Cell Cycle-regulated Kinase That Is Localized near Centrosomes and Influences Microtubule Organization.
Swenson KI, Winkler KE, Means AR.
xMiRP2 aagggaaccacacggacgcca J Biol Chem 2003 Jan 15
RNAi reveals endogenous Xenopus MiRPs govern mammalian K+ channel function in oocyte expression studies.
Anantharam A, Lewis A, Panaghie G, Gordon E, McCrossan ZA, Lerner DJ, Abbott GW.
p110É¿ aaauuccagugguucauuccaTT
uggaaugaaccacuggaauuuTT		 Nucleic Acids Res 2003 Jan 15;31(2):670-82
Functional studies of the PI(3)-kinase signalling pathway employing synthetic and expressed siRNA.
Czauderna F, Fechtner M, Aygun H, Arnold W, Klippel A, Giese K, Kaufmann J.
p110 auauuccugagcuugauaccaTT
ugguaucaagcucaggaauauTT		 Nucleic Acids Res 2003 Jan 15;31(2):670-82
Functional studies of the PI(3)-kinase signalling pathway employing synthetic and expressed siRNA.
Czauderna F, Fechtner M, Aygun H, Arnold W, Klippel A, Giese K, Kaufmann J.
akt1

acgaggggaguacaucaagacaa-

aagucuugauguacuccccucgu

 Nucleic Acids Res 2003 Jan 15;31(2):670-82
Functional studies of the PI(3)-kinase signalling pathway employing synthetic and expressed siRNA.
Czauderna F, Fechtner M, Aygun H, Arnold W, Klippel A, Giese K, Kaufmann J.
akt2

cuccuucauuggguacaaggaaaa-

aaaaaaaauccuuguacccaaugaaggag

 Nucleic Acids Res 2003 Jan 15;31(2):670-82
Functional studies of the PI(3)-kinase signalling pathway employing synthetic and expressed siRNA.
Czauderna F, Fechtner M, Aygun H, Arnold W, Klippel A, Giese K, Kaufmann J.
hTF167i gcgcuucaggcacuacaaaua
uuuguagugccugaagcgccg		 Nucleic Acids Res 2003 Jan 15;31(2):589-95
Tolerance for mutations and chemical modifications in a siRNA.
Amarzguioui M, Holen T, Babaie E, Prydz H.
EGFP Curr Biol 2003 Jan 8;13(1):41-6
Short-Interfering-RNA-Mediated Gene Silencing in Mammalian Cells Requires Dicer and eIF2C Translation Initiation Factors.
Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, Saigo K.
DsRed Curr Biol 2003 Jan 8;13(1):41-6
Short-Interfering-RNA-Mediated Gene Silencing in Mammalian Cells Requires Dicer and eIF2C Translation Initiation Factors.
Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, Saigo K.
firefly luc Curr Biol 2003 Jan 8;13(1):41-6
Short-Interfering-RNA-Mediated Gene Silencing in Mammalian Cells Requires Dicer and eIF2C Translation Initiation Factors.
Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, Saigo K.
human dicer NM_153402 ATTGATGTCTACCTCTATGAAGT-dTdT Curr Biol 2003 Jan 8;13(1):41-6
Short-Interfering-RNA-Mediated Gene Silencing in Mammalian Cells Requires Dicer and eIF2C Translation Initiation Factors.
Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, Saigo K.
mouse dicer Curr Biol 2003 Jan 8;13(1):41-6
Short-Interfering-RNA-Mediated Gene Silencing in Mammalian Cells Requires Dicer and eIF2C Translation Initiation Factors.
Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, Saigo K.
human eIF2C4 NM_153177 TATGGTGCGGCACTTCAAGATGC-dTdT Curr Biol 2003 Jan 8;13(1):41-6
Short-Interfering-RNA-Mediated Gene Silencing in Mammalian Cells Requires Dicer and eIF2C Translation Initiation Factors.
Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, Saigo K.
human eIF2C3 NM_153402 ATTGATGTCTACCTCTATGAAGT-dTdT Curr Biol 2003 Jan 8;13(1):41-6
Short-Interfering-RNA-Mediated Gene Silencing in Mammalian Cells Requires Dicer and eIF2C Translation Initiation Factors.
Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, Saigo K.
mouse eIF2C3 Curr Biol 2003 Jan 8;13(1):41-6
Short-Interfering-RNA-Mediated Gene Silencing in Mammalian Cells Requires Dicer and eIF2C Translation Initiation Factors.
Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, Saigo K.
human eIF2C4 Curr Biol 2003 Jan 8;13(1):41-6
Short-Interfering-RNA-Mediated Gene Silencing in Mammalian Cells Requires Dicer and eIF2C Translation Initiation Factors.
Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, Saigo K.
mouse eIF2C4 Curr Biol 2003 Jan 8;13(1):41-6
Short-Interfering-RNA-Mediated Gene Silencing in Mammalian Cells Requires Dicer and eIF2C Translation Initiation Factors.
Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, Saigo K.
mPEN-1 aaggctatgtttggcgctcag J Biol Chem 2003 Jan 8
PEN-2 and APH-1 coordinately regulate proteolytic processing of presenilin 1.
Luo WJ, Wang H, Li H, Kim BS, Shah S, Lee HJ, Thinakaran G, Kim TW, Yu G, Xu H.
APH-1a aaggcagatgagggcttagca J Biol Chem 2003 Jan 8
PEN-2 and APH-1 coordinately regulate proteolytic processing of presenilin 1.
Luo WJ, Wang H, Li H, Kim BS, Shah S, Lee HJ, Thinakaran G, Kim TW, Yu G, Xu H.
hPEN-1 aaaggctatgtctggcgctca J Biol Chem 2003 Jan 8
PEN-2 and APH-1 coordinately regulate proteolytic processing of presenilin 1.
Luo WJ, Wang H, Li H, Kim BS, Shah S, Lee HJ, Thinakaran G, Kim TW, Yu G, Xu H.
POSH gucagacuucuggauggcaTC EMBO J 2003 Jan 15;22(2):252-61
POSH acts as a scaffold for a multiprotein complex that mediates JNK activation in apoptosis.
Xu Z, Kukekov NV, Greene LA.
OPA1 AB011139 AAGTTATCAGTCTGAGCCAGG-dTdT J Biol Chem 2002 Dec 31
Loss of OPA1 perturbates the mitochondrial inner membrane structure and integrity, leading to cytochrome c release and apoptosis.
Olichon A, Baricault L, Gas N, Guillou E, Valette A, Belenguer P, Lenaers G.
kinesin Eg5 Biotechniques 2002 Dec;33(6):1244-8
Targeting the kinesin Eg5 to monitor siRNA transfection in mammalian cells.
Weil D, Garcon L, Harper M, Dumenil D, Dautry F, Kress M.
CD54 J Biol Chem 2002 Dec 23
Efficient reduction of target RNA's by siRNA and RNase H dependent antisense agents: A comparative analysis.
Vickers TA, Koo S, Bennett CF, Crooke ST, Dean NM, Baker BF.
PTEN J Biol Chem 2002 Dec 23
Efficient reduction of target RNA's by siRNA and RNase H dependent antisense agents: A comparative analysis.
Vickers TA, Koo S, Bennett CF, Crooke ST, Dean NM, Baker BF.
DLP1 J Biol Chem 2002 Dec 23
The dynamin-like protein DLP1 is involved inperoxisomal fission.
Koch A, Thiemann M, Grabenbauer M, Yoon Y, McNiven MA, Schrader M.
DNMT1 aagcatgagcaccgttctcc Nat Genet 2002 Dec 23
DNMT1 is required to maintain CpG methylation and aberrant gene silencing in human cancer cells.
Robert MF, Morin S, Beaulieu N, Gauthier F, Chute IC, Barsalou A, MacLeod AR.
CPI-17 aagtggatcgacggatgcttg Neuron 2002 Dec 19;36(6):1145-1158
Cerebellar Long-Term Synaptic Depression Requires PKC-Mediated Activation of CPI-17, a Myosin/Moesin Phosphatase Inhibitor.
Eto M, Bock R, Brautigan DL, Linden DJ.
PHI-1 Neuron 2002 Dec 19;36(6):1145-1158
Cerebellar Long-Term Synaptic Depression Requires PKC-Mediated Activation of CPI-17, a Myosin/Moesin Phosphatase Inhibitor.
Eto M, Bock R, Brautigan DL, Linden DJ.
PLC-gamma1 aaacaaccggctcttcgtc Cell 2002 Nov 15;111(4):529-41
Phospholipase C-gamma is required for agonist-induced Ca2+ entry.
Patterson RL, van Rossum DB, Ford DL, Hurt KJ, Bae SS, Suh PG, Kurosaki T, Snyder SH, Gill DL.
PCL-gamma2 aatcctgacttccgggaaa Cell 2002 Nov 15;111(4):529-41
Phospholipase C-gamma is required for agonist-induced Ca2+ entry.
Patterson RL, van Rossum DB, Ford DL, Hurt KJ, Bae SS, Suh PG, Kurosaki T, Snyder SH, Gill DL.
RasGRP4 J Biol Chem 2002 Dec 18
RasGRP4 regulates the expression of prostaglandin D2 in human and rat mast cell lines.
Li L, Yang Y, Stevens RL.
epicardin/capsulin/Pod-1 aaggccttctccagactcaag J Biol Chem 2002 Dec 19
Basic helix-loop-helix transcription factor epicardin/capsulin/Pod-1 suppresses differentiation by negative regulation of transcription.
Funato N, Ohyama K, Kuroda T, Nakamura M.
DP97 gaagaagucuggaggcuucTT
gaagccuccagacuucuucTT		 J Biol Chem 2002 Dec 3
Regulation of nuclear receptor transcriptional activity by a novel DEAD box RNA helicase (DP97).
Rajendran RR, Nye AC, Frasor J, Balsara RD, Martini PG, Katzenellenbogen BS.
HuR guugaaucugcaaaacuuaTT
uaaguuuugcagauucaacTT		 Genes Dev 2002 Dec 1;16(23):3087-99
ELAV/Hu proteins inhibit p27 translation via an IRES element in the p27 5'UTR.
Kullmann M, Gopfert U, Siewe B, Hengst L.
HuR ugugaaagugauccgcgacTT
gucgcggaucacuuucacaTT		 Genes Dev 2002 Dec 1;16(23):3087-99
ELAV/Hu proteins inhibit p27 translation via an IRES element in the p27 5'UTR.
Kullmann M, Gopfert U, Siewe B, Hengst L.
rat MafK aaggaggaggtaactcggctg J Neurosci 2002 Oct 15;22(20):8971-80
The basic region and leucine zipper transcription factor MafK is a new nerve growth factor-responsive immediate early gene that regulates neurite outgrowth.
Torocsik B, Angelastro JM, Greene LA.
PP2A aaatgtgcaagaggttcgttg augugcaagagguucguugTT
caacgaaccucuugcacauTT		 J Biol Chem 2002 Nov 19
Protein phosphatase 2A and phosphoprotein SET regulate androgen production by P450c17.
Pandey AV, Mellon SH, Miller WL.
PP2A aatgtctgcgaaagtatggga ugucugcgaaaguaugggaTT
ucccauacuuucgcagacaTT		 J Biol Chem 2002 Nov 19
Protein phosphatase 2A and phosphoprotein SET regulate androgen production by P450c17.
Pandey AV, Mellon SH, Miller WL.
PP2A aattggtgtcatgatcggaat uuggugucaugaucggaauTT
auuccgaucaugacaccaaTT		 J Biol Chem 2002 Nov 19
Protein phosphatase 2A and phosphoprotein SET regulate androgen production by P450c17.
Pandey AV, Mellon SH, Miller WL.
PP4 aaggccagagagatcttggta ggccagagagaucuugguaTT
uaccaagaucucucuggccTT		 J Biol Chem 2002 Nov 19
Protein phosphatase 2A and phosphoprotein SET regulate androgen production by P450c17.
Pandey AV, Mellon SH, Miller WL.
PP4 aatcgaccgaaagcaagaggt ucgaccgaaagcaagagguTT
accucuugcuuucggucgaTT		 J Biol Chem 2002 Nov 19
Protein phosphatase 2A and phosphoprotein SET regulate androgen production by P450c17.
Pandey AV, Mellon SH, Miller WL.
PP4 aagtggcacttcaatgagacg guggcacuucaaugagacgTT
cgucucauugaagugccacTT		 J Biol Chem 2002 Nov 19
Protein phosphatase 2A and phosphoprotein SET regulate androgen production by P450c17.
Pandey AV, Mellon SH, Miller WL.
DNA-PKcs gaucgcaccuuacucuguuTT
aacagaguaaggugcgaucTT		 Cancer Res 2002 Nov 15;62(22):6400-4
Silencing Expression of the Catalytic Subunit of DNA-dependent Protein Kinase by Small Interfering RNA Sensitizes Human Cells for Radiation-induced Chromosome Damage, Cell Killing, and Mutation.
Peng Y, Zhang Q, Nagasawa H, Okayasu R, Liber HL, Bedford JS.
DNA-PKcs cuuuaugguggccauggagTT
cuccauggccaccauaaagTT		 Cancer Res 2002 Nov 15;62(22):6400-4
Silencing Expression of the Catalytic Subunit of DNA-dependent Protein Kinase by Small Interfering RNA Sensitizes Human Cells for Radiation-induced Chromosome Damage, Cell Killing, and Mutation.
Peng Y, Zhang Q, Nagasawa H, Okayasu R, Liber HL, Bedford JS.
CD4  

Small interfering RNA-mediated gene silencing in T lymphocytes.
J Immunol. 2002 Nov 15;169(10):5754-60.
http://www.jimmunol.org/cgi/content/full/169/10/5754 McManus MT, Haines BB, Dillon CP, Whitehurst CE, van Parijs L, Chen J, Sharp PA.

CD8alpha  

Small interfering RNA-mediated gene silencing in T lymphocytes.
J Immunol. 2002 Nov 15;169(10):5754-60.
McManus MT, Haines BB, Dillon CP, Whitehurst CE, van Parijs L, Chen J, Sharp PA.

p21Cip1/Waf1 aacggtggaactttgacttcg Genes Dev 2002 Nov 15;16(22):2923-34
Cdk4 disruption renders primary mouse cells resistant to oncogenic transformation, leading to Arf/p53-independent senescence.
Zou X, Ray D, Aziyu A, Christov K, Boiko AD, Gudkov AV, Kiyokawa H.
KLF4 J Biol Chem 2002 Nov 8
Kruppel-like factor 4 mediates p53-dependent G1/S cell cycle arrest in response to DNA damage.
Yoon HS, Chen X, Yang VW.
luciferase ucgaaguauuccgcguacgug
cguacgcggaauacuucgauu		 Mol Cell 2002 Sep;10(3):537-48
Evidence that siRNAs Function as Guides, Not Primers, in the Drosophila and Human RNAi Pathways.
Schwarz DS, Hutvagner G, Haley B, Zamore PD.
GFP gcagcacgacuucuucaagTT
cuugaagaagucgugcugcTT		 Mol Cell 2002 Sep;10(3):549-61
RNAi in Human Cells. Basic Structural and Functional Features of Small Interfering RNA.
Chiu YL, Rana TM.
RFP gugggagcgcgugaugaacTT
guucaucacgcgcucccacTT		 Mol Cell 2002 Sep;10(3):549-61
RNAi in Human Cells. Basic Structural and Functional Features of Small Interfering RNA.
Chiu YL, Rana TM.
ADAR2 uacaugagugaucguggccuu
ggccacgaucacucauguauu		 Proc Natl Acad Sci U S A 2002 Oct 24
Replicating hepatitis delta virus RNA is edited in the nucleus by the small form of ADAR1.
Wong SK, Lazinski DW.
ADAR1 ccagcacagcggagugguauu
uaccacuccgcugugcugguu		 Proc Natl Acad Sci U S A 2002 Oct 24
Replicating hepatitis delta virus RNA is edited in the nucleus by the small form of ADAR1.
Wong SK, Lazinski DW.
ADAR1 gacccgcggaguuucccguuu
acgggaaacuccgcgggucug		 Proc Natl Acad Sci U S A 2002 Oct 24
Replicating hepatitis delta virus RNA is edited in the nucleus by the small form of ADAR1.
Wong SK, Lazinski DW.
hACBP Biochem J 2002 Oct 23
Acyl-CoA binding protein is an essential protein in mammalian cell lines.
Faergeman NJ, Knudsen J.
bcr-abl gcagaguucaaaagcccuuTT
aagggcuuuugaacucugcTT		 Blood 2002 Sep 26
Specific inhibition of bcr-abl gene expression by small interfering RNA.
Scherr M, Battmer K, Winkler T, Heidenreich O, Ganser A, Eder M.
bcr-abl agcagaguucaaaagcccuTT
agggcuuuugaacucugcuTT		 Blood 2002 Sep 26
Specific inhibition of bcr-abl gene expression by small interfering RNA.
Scherr M, Battmer K, Winkler T, Heidenreich O, Ganser A, Eder M.
luciferase cauucuauccucuagaggaugTT J Immunol 2002 Nov 1;169(9):5196-5201
Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference.
Capodici J, Kariko K, Weissman D.
HXB2 gagaaccaaggggaagugacaTT J Immunol 2002 Nov 1;169(9):5196-5201
Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference.
Capodici J, Kariko K, Weissman D.
hSPK1 gggcaaggccttgcagctcTT Mol Cell Biol 2002 Nov 15;22(22):7758-7768
Sphingosine Kinase Mediates Vascular Endothelial Growth Factor-Induced Activation of Ras and Mitogen-Activated Protein Kinases.
Shu X, Wu W, Mosteller RD, Broek D.
     
    McManus MT, Haines BB, Dillon CP, Whitehurst CE, van Parijs L, Chen J, Sharp PA.
Related Articles, Links
Small interfering RNA-mediated gene s
hSPK2 gccaggccccggggtggccTT Mol Cell Biol 2002 Nov 15;22(22):7758-7768
Sphingosine Kinase Mediates Vascular Endothelial Growth Factor-Induced Activation of Ras and Mitogen-Activated Protein Kinases.
Shu X, Wu W, Mosteller RD, Broek D.
GS15 Mol Biol Cell 2002 Oct;13(10):3493-3507
GS15 Forms a SNARE Complex with Syntaxin 5, GS28, and Ykt6 and Is Implicated in Traffic in the Early Cisternae of the Golgi Apparatus.
Xu Y, Martin S, James DE, Hong W.
GS15 Mol Biol Cell 2002 Oct;13(10):3493-3507
GS15 Forms a SNARE Complex with Syntaxin 5, GS28, and Ykt6 and Is Implicated in Traffic in the Early Cisternae of the Golgi Apparatus.
Xu Y, Martin S, James DE, Hong W.
BRF1 caagaugcucaacuauaguTT
acuauaguugagcaucuugTT		 EMBO J 2002 Sep 2;21(17):4709-18
Functional cloning of BRF1, a regulator of ARE-dependent mRNA turnover.
Stoecklin G, Colombi M, Raineri I, Leuenberger S, Mallaun M, Schmidlin M, Gross B, Lu M, Kitamura T, Moroni C.
murineIL-3 ccagaacguugaauugcagTT
cugcaauucaacguucuggTT		 EMBO J 2002 Sep 2;21(17):4709-18
Functional cloning of BRF1, a regulator of ARE-dependent mRNA turnover.
Stoecklin G, Colombi M, Raineri I, Leuenberger S, Mallaun M, Schmidlin M, Gross B, Lu M, Kitamura T, Moroni C.
hERAAP agctagtaatggagactca Nature 2002 Oct 3;419(6906):480-3
ERAAP customizes peptides for MHC class I molecules in the endoplasmic reticulum.
Serwold T, Gonzalez F, Kim J, Jacob R, Shastri N.
mERAAP cgtagtgatgggacaccat Nature 2002 Oct 3;419(6906):480-3
ERAAP customizes peptides for MHC class I molecules in the endoplasmic reticulum.
Serwold T, Gonzalez F, Kim J, Jacob R, Shastri N
PKCdelta gaugaaggaggcgcucagTT
 J Biol Chem 2002 Oct 10;107(1)
Activation of SAPK/JNK signaling by protein kinase C delta in response to DNA damage.
Kiyotsugu K, Miki Y, Kufe D.
PKCdelta ggcugaguucuggcuggacTT J Biol Chem 2002 Oct 10;107(1)
Activation of SAPK/JNK signaling by protein kinase C delta in response to DNA damage.
Kiyotsugu K, Miki Y, Kufe D.
EZH2 Nature 2002 Oct 10;419(6907):624-9
The polycomb group protein EZH2 is involved in progression of prostate cancer.
Varambally S, Dhanasekaran SM, Zhou M, Barrette TR, Kumar-Sinha C, Sanda MG, Ghosh D, Pienta KJ, Sewalt RG, Otte AP, Rubin MA, Chinnaiyan AM.
p8 ggacguaccaagagagaagCT
cuucucucuugguacguccTT		 EMBO J 2002 Oct 15;21(20):5427-5436
Signaling pathways and late-onset gene induction associated with renal mesangial cell hypertrophy.
Goruppi S, Bonventre JV, Kyriakis JM.
53BP1 gccagguucuagaggaugaTT
ucauccucuagaaccuggcTT		 Science 2002 Oct 3
53BP1, a Mediator of the DNA Damage Checkpoint.
Wang B, Matsuoka S, Carpenter PB, Elledge SJ.
53BP1 gauacuccuugccugauaaTT
uuaucaggcaaggaguaucTT		 Science 2002 Oct 3
53BP1, a Mediator of the DNA Damage Checkpoint.
Wang B, Matsuoka S, Carpenter PB, Elledge SJ.
lacZ cguacgcggaauacuucgaTT
ucgaaguauuccgcguacgTT		 Science 2002 Oct 3
53BP1, a Mediator of the DNA Damage Checkpoint.
Wang B, Matsuoka S, Carpenter PB, Elledge SJ.
GFP gacccgcgccgaggugaaguu
cuucaccucggcgcgggucuu		 Science 2002 Oct 3
53BP1, a Mediator of the DNA Damage Checkpoint.
Wang B, Matsuoka S, Carpenter PB, Elledge SJ.
Btk ttggtaaacgatcaaggag uugguaaacgaucaaggagTT
cuccuugaucguuuaccaaTT		 FEBS Lett 2002 Sep 11;527(1-3):274
Silencing of Bruton's tyrosine kinase (Btk) using short interfering RNA duplexes (siRNA).
Heinonen J, Smith C, Nore B.
Btk gggaaagaaggaggtttca gggaaagaaggagguuucaTT
ugaaaccuccuucuuucccTT		 FEBS Lett 2002 Sep 11;527(1-3):274
Silencing of Bruton's tyrosine kinase (Btk) using short interfering RNA duplexes (siRNA).
Heinonen J, Smith C, Nore B.
Btk gaagcttaaaacctgggag gaagcuuaaaaccugggagTT
cucccaccuuuuaagcuucTT		 FEBS Lett 2002 Sep 11;527(1-3):274
Silencing of Bruton's tyrosine kinase (Btk) using short interfering RNA duplexes (siRNA).
Heinonen J, Smith C, Nore B.
Bmx aaagaaggagcatttatgg aaagaaggagcauuuauggTT
ccauaaaugcuccuucuuuTT		 FEBS Lett 2002 Sep 11;527(1-3):274
Silencing of Bruton's tyrosine kinase (Btk) using short interfering RNA duplexes (siRNA).
Heinonen J, Smith C, Nore B.
EGFP ggagttgtcccaattcttg ggaguugucccaauucuugTT
caagaauugggacaacuccTT		 FEBS Lett 2002 Sep 11;527(1-3):274
Silencing of Bruton's tyrosine kinase (Btk) using short interfering RNA duplexes (siRNA).
Heinonen J, Smith C, Nore B.
luciferase cacttacgctgagtacttcgaaa cuuacgcugaguacuucgaTT
ucgaaguacucagcguaagTT		 Nat Genet 2002 Sep;32(1):107-108
Efficient delivery of siRNA for inhibition of gene expression in postnatal mice.
Lewis DL, Hagstrom JE, Loomis AG, Wolff JA, Herweijer H.
EGFP gcgacgtaaacggccacaagttc gacguaaacggccacaaguuc
acuuguggccguuuacgucgc		 Nat Genet 2002 Sep;32(1):107-108
Efficient delivery of siRNA for inhibition of gene expression in postnatal mice.
Lewis DL, Hagstrom JE, Loomis AG, Wolff JA, Herweijer H.
SEAP caagggcaacttccagaccattg agggcaacuuccagaccauTT
auggucuggaaguugcccuTT		 Nat Genet 2002 Sep;32(1):107-108
Efficient delivery of siRNA for inhibition of gene expression in postnatal mice.
Lewis DL, Hagstrom JE, Loomis AG, Wolff JA, Herweijer H.
Hepatitis B virus antigen aatcactcaccaacctcttgtcc ucacucaccaaccucuuguTT
acaagagguuggugagugaTT		 Nat Genet 2002 Sep;32(1):107-108
Efficient delivery of siRNA for inhibition of gene expression in postnatal mice.
Lewis DL, Hagstrom JE, Loomis AG, Wolff JA, Herweijer H.
pBluescript cggtaagacacgacttatcgcca guaagacacgacuuaucgcTT
gcgauaagucgugucuuacTT		 Nat Genet 2002 Sep;32(1):107-108
Efficient delivery of siRNA for inhibition of gene expression in postnatal mice.
Lewis DL, Hagstrom JE, Loomis AG, Wolff JA, Herweijer H.
luciferase cgtacgcggaatacttcga cguacgcggaauacuucgaTT
ucgaaguauuccgcguacgTT		 J Biol Chem 2002 Jul 30
Physical and functional interaction between MCL1 and fortilin. The potential role of MCL1 as a fortilin chaperone.
Zhang D, Li F, Weidner D, Mnjoyan ZH, Fujise K.
laminB1 aacgcgcttggtagaggtgga Oncogene 2002 Jul 18;21(31):4715-27
p53 induces the expression of its antagonist p73 Delta N, establishing an autoregulatory feedback loop.
Kartasheva NN, Contente A, Lenz-Stoppler C, Roth J, Dobbelstein
p73 aaccacgagctcgggagggac Oncogene 2002 Jul 18;21(31):4715-27
p53 induces the expression of its antagonist p73 Delta N, establishing an autoregulatory feedback loop.
Kartasheva NN, Contente A, Lenz-Stoppler C, Roth J, Dobbelstein
GFP caagcugacccugaaguucuu
gaacuucagggucagcuugug		 Proc Natl Acad Sci U S A 2002 Aug 21
RNAi functions in cultured mammalian neurons.
Krichevsky AM, Kosik KS.
dsRed2 aguuccaguacggcuccaauu
uuggagccguacuggaacuug		 Proc Natl Acad Sci U S A 2002 Aug 21
RNAi functions in cultured mammalian neurons.
Krichevsky AM, Kosik KS.
MAP2 cgagaggaaagacgaaggauu
uccuucgucuuuccucucgug		 Proc Natl Acad Sci U S A 2002 Aug 21
RNAi functions in cultured mammalian neurons.
Krichevsky AM, Kosik KS.
YB-1 cagggcaccuauucagauauu
uaucugaauaggugcccugug		 Proc Natl Acad Sci U S A 2002 Aug 21
RNAi functions in cultured mammalian neurons.
Krichevsky AM, Kosik KS.
ORC6 aatggtagccacatccggtgt Science 2002 Aug 9;297(5583):1026-31
Orc6 involved in DNA replication, chromosome segregation, and cytokinesis.
Prasanth SG, Prasanth KV, Stillman B
ORC6 aagattggacagcaggtcgac Science 2002 Aug 9;297(5583):1026-31
Orc6 involved in DNA replication, chromosome segregation, and cytokinesis.
Prasanth SG, Prasanth KV, Stillman B
Fortilin aaggtaacattgatgactcgc gguaacauugaugacucgcTT
gcgagucaucaauguuaccTT		 J Biol Chem 2002 Jul 30
Physical and functional interaction between MCL1 and fortilin. The potential role of MCL1 as a fortilin chaperone.
Zhang D, Li F, Weidner D, Mnjoyan ZH, Fujise K.
MCL1 aataacaccagtacggacggg uaacaccaguacggacgggTT
cccguccguacugguguuTT		 J Biol Chem 2002 Jul 30
Physical and functional interaction between MCL1 and fortilin. The potential role of MCL1 as a fortilin chaperone.
Zhang D, Li F, Weidner D, Mnjoyan ZH, Fujise K.
Luciferase cuuacgcugaguacuucgaTT
ucgaaguacucagcguaagTT		 Nature 2002 Jul 4;418(6893):38-9
RNA interference in adult mice.
McCaffrey AP, Meuse L, Pham TT, Conklin DS, Hannon GJ, Kay MA.
NS5B cugugagaucuacggagccugTT
caggcuccguagaucucacagTT		 Nature 2002 Jul 4;418(6893):38-9
RNA interference in adult mice.
McCaffrey AP, Meuse L, Pham TT, Conklin DS, Hannon GJ, Kay MA.
hKIS aagcagttcttgccgccagga EMBO J 2002 Jul 1;21(13):3390-401
A growth factor-dependent nuclear kinase phosphorylates p27(Kip1) and regulates cell cycle progression.
Boehm M, Yoshimoto T, Crook MF, Nallamshetty S, True A, Nabel GJ, Nabel EG.
mKIS aagcagttcctgcctcgggga EMBO J 2002 Jul 1;21(13):3390-401
A growth factor-dependent nuclear kinase phosphorylates p27(Kip1) and regulates cell cycle progression.
Boehm M, Yoshimoto T, Crook MF, Nallamshetty S, True A, Nabel GJ, Nabel EG.
hPlk1 aagggcggctttgccaagtgctt Proc Natl Acad Sci U S A 2002 Jun 25;99(13):8672-6
Activation of Cdc2/cyclin B and inhibition of centrosome amplification in cells depleted of Plk1 by siRNA.
Liu X, Erikson RL.
CD4 gaucaagagacuccucaguGA
acugaggagucucuugaucTG		 Nat Med 2002 Jul;8(7):681-6
siRNA-directed inhibition of HIV-1 infection.
Novina CD, Murray MF, Dykxhoorn DM, Beresford PJ, Riess J, Lee SK, Collman RG, Lieberman J, Shankar P, Sharp PA.
p24 gauuguacugagagacaggcu
ccugucucucaguacaaucuu		 Nat Med 2002 Jul;8(7):681-6
siRNA-directed inhibition of HIV-1 infection.
Novina CD, Murray MF, Dykxhoorn DM, Beresford PJ, Riess J, Lee SK, Collman RG, Lieberman J, Shankar P, Sharp PA.
GFP ggcuacguccaggagcgcacc
ugcgcuccuggacguagccuu		 Nat Med 2002 Jul;8(7):681-6
siRNA-directed inhibition of HIV-1 infection.
Novina CD, Murray MF, Dykxhoorn DM, Beresford PJ, Riess J, Lee SK, Collman RG, Lieberman J, Shankar P, Sharp PA.
HPRT gugucauuagugaaacuggaa
ccaguuucacuaaugacacaa		 Nat Med 2002 Jul;8(7):681-6
siRNA-directed inhibition of HIV-1 infection.
Novina CD, Murray MF, Dykxhoorn DM, Beresford PJ, Riess J, Lee SK, Collman RG, Lieberman J, Shankar P, Sharp PA.
CD19 uaguaggaggcaggccccaga
gaaucauccuccguccggggu		 Nat Med 2002 Jul;8(7):681-6
siRNA-directed inhibition of HIV-1 infection.
Novina CD, Murray MF, Dykxhoorn DM, Beresford PJ, Riess J, Lee SK, Collman RG, Lieberman J, Shankar P, Sharp PA.
hRad9 aagtctttcctgtctgtcttc J Biol Chem 2002 Jul 12;277(28):25722-7
A role of the C-terminal region of human Rad9 (hRad9) in nuclear transport of the hRad9 checkpoint complex.
Hirai I, Wang HG.
GFP aagacccgcgccgaggtgaag J Biol Chem 2002 Jul 12;277(28):25722-7
A role of the C-terminal region of human Rad9 (hRad9) in nuclear transport of the hRad9 checkpoint complex.
Hirai I, Wang HG.
MBD2 aagaggattgcccggcc J Biol Chem 2002 Jun 21;277(25):22573-80
Methyl-CpG binding domain protein 2 represses transcription from hypermethylated pi-class glutathione S-transferase gene promoters in hepatocellular carcinoma cells.
Bakker J, Lin X, Nelson WG.
MeCP2 aagcatgagcccgtgcagcca J Biol Chem 2002 Jun 21;277(25):22573-80
Methyl-CpG binding domain protein 2 represses transcription from hypermethylated pi-class glutathione S-transferase gene promoters in hepatocellular carcinoma cells.
Bakker J, Lin X, Nelson WG.
lamin A aaggacctggaggctctgctg J Biol Chem 2002 Jun 21;277(25):22573-80
Methyl-CpG binding domain protein 2 represses transcription from hypermethylated pi-class glutathione S-transferase gene promoters in hepatocellular carcinoma cells.
Bakker J, Lin X, Nelson WG.
hMps1 EMBO J 2002 Apr 2;21(7):1723-32
Human Mps1 kinase is required for the spindle assembly checkpoint but not for centrosome duplication.
Stucke VM, Sillje HH, Arnaud L, Nigg EA.
h/m-shc cuacuugguucgguacauggg
cauguaccgaaccaaguagga		 Biochem J 2002 Apr 1;363(Pt 1):1-5
Isoform-specific knockdown and expression of adaptor protein ShcA using small interfering RNA.
Kisielow M, Kleiner S, Nagasawa M, Faisal A, Nagamine Y.
p66-shc gaaugagucucugucaucguc
cgaugacagagacucauuccg		 Biochem J 2002 Apr 1;363(Pt 1):1-5
Isoform-specific knockdown and expression of adaptor protein ShcA using small interfering RNA.
Kisielow M, Kleiner S, Nagasawa M, Faisal A, Nagamine Y.
Cdc14A gcacagtaaatacccactatt Nat Cell Biol 2002 Apr;4(4):318-22
Deregulated human Cdc14A phosphatase disrupts centrosome separation and chromosome segregation.
Mailand N, Lukas C, Kaiser BK, Jackson PK, Bartek J, Lukas J.
NuMA NM_006185 AGCAACAGTGCCAGAGCTGCAGA-dTdT J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
GAS41 NM_006530 AAGAAAAGAGAAGAAGATGGGCA-dTdT J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
SV40 T-antigen J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
laminA/C NM_005572 TCGGCTGAAGGACCTGGAGGCTC-dTdT J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
lamin B1 NM_005573 AAGCTGCAGATCGAGCTGGGCAA-dTdT J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
lamin B2 M94362 AAGAGGAGGAGGAAGCCGAGTTT-dTdT J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
LAP2 J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
emerin J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
Nup153 NM_005124 AGTGTTCAGTATGCTGTGTTTCT-dTdT J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
beta-actin J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
beta-actin J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
ARC21 AF006086 TGTCTTCTTCAAAAACTATGAAA-dTdT J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
mouse zyxin X99063 TCAGAGGCAGAGCGTGGCAGTGA-dTdT J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
mouse vinculin J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
VASP J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
vimentin J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
keratin18 J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
Eg5 J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
CENP-E J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
cytoplasmic dynein 1 heavy chain J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
cdk1 J Cell Sci 2001 Dec;114(Pt 24):4557-65
Identification of essential genes in cultured mammalian cells using small interfering RNAs.
Harborth J, Elbashir SM, Bechert K, Tuschl T, Weber K.
SK-1 gagcugcaaggccuugcccTT
gggcaaggccuugcagcucTT		 J Biol Chem 2002 Feb 22;277(8):6667-75
Extracellular export of sphingosine kinase-1 enzyme. Sphingosine 1-phosphate generation and the induction of angiogenic vascular maturation.
Ancellin N, Colmont C, Su J, Li Q, Mittereder N, Chae SS, Stefansson S, Liau G, Hla T.
GL-2, GL-3 luciferase Nature 2001 May 24;411(6836):494-8
Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.
Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T.
pRL-TK Nature 2001 May 24;411(6836):494-8
Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.
Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T.
lamin A/C Nature 2001 May 24;411(6836):494-8
Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.
Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T.
laminB1 Nature 2001 May 24;411(6836):494-8
Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.
Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T.
NyMA Nature 2001 May 24;411(6836):494-8
Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.
Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T.
vimentin Nature 2001 May 24;411(6836):494-8
Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.
Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T.