HIGH RESOLUTION GENETIC FOOTPRINTING
HOME PAGE

This web site was designed to provide detailed protocols for genetic footprinting, a technique for high-resolution mapping of the functional organization of cloned genes (Singh, Crowley and Brown (1997) PNAS 94: 1304-1309). See below for an introduction to high-resolution genetic footprinting, as well as a collection of current protocols. Comments or questions about this site should be directed to Rachel Crowley (rachel@cmgm.stanford.edu).

The Yeast Genome Center at Stanford University is applying genetic footprinting on a genome-wide scale, with the goal of obtaining functional information for all of the ORFs in the Saccharomyces cerevisiae genome (described in Smith et al. (1996) Science 274: 2069-2074 and Smith, Botstein, and Brown (1995) PNAS 92: 6479-6483.) See the Brown lab home page for more information about genetic footprinting of the yeast genome.

ORGANIZATION OF THIS SITE

Introduction to high-resolution genetic footprinting

Overview of materials needed

Purification of MLV Integrase

Generation of insertional mutants

Generation of block substitution mutants

PCR-based analysis of insertional and substitution mutants

Appendix (contains additional information about specific steps in the protocol; notes are referenced within the text by bracketed numbers, e.g., [1], [2], etc.)

INTRODUCTION TO GENETIC FOOTPRINTING

Genetic footprinting is a technique for high-resolution mapping of the functional organization of a cloned gene. An in vitro transposition reaction with purified retroviral integrase is used to generate a large library of mutants, each of which bears an insertion or block substitution mutation of defined sequence at some position within the gene. The library of mutants is simultaneously subjected to one or more genetic selections, and DNA is made from the library of mutants before and after selection. The presence or absence of individual mutants within each population is determined by PCR analysis, in which each mutant within the library gives rise to a PCR product of unique electrophoretic mobility. Comparison of PCR product bands before and after selection allows reconstruction of the features of the gene that are essential for the function that has been selected. For more information, see Singh, Crowley and Brown (1997) PNAS 94: 1304-1309.

MATERIALS REQUIRED

1.) A construct containing the gene to be mutagenized, and lacking recognition sites for the restriction enzymes that are used in the mutagenesis procedure (typically, Not I and Bsg I).

This mutagenesis protocol requires that the construct be no larger than 2.5 kb, so it may be necessary to subdivide the region of interest into smaller parts for the mutagenesis. The piAN13 vector, which is 894 bp and carries the supF gene as a selectable marker, is our vector of choice for mutagenesis. To obtain the piAN13 vector and the strain for selection of this vector, send a request by email to molsen@cmgm.stanford.edu.

If the construct to be mutagenized contains recognition sites for Not I and/or Bsg I, these can be removed by site directed mutagenesis. Alternatively, the genetic footprinting strategy can be designed around other enzymes (see section 3 below for design of alternative substrates).

2.) MLV integrase enzyme.

Moloney Murine Leukemia Virus Integrase (MLV IN) is purified as a fusion to glutathione S-transferase. A single-step glutathione agarose affinity purification generates enzyme of sufficient purity for the mutagenesis. A detailed protocol for this purification, including the materials required, is found below. For the MLV integrase expression strain, send a request by email to molsen@cmgm.stanford.edu.

3.) Oligonucleotide substrates for MLV integrase.

Our oligonucleotide substrate of choice contains restriction sites for the enzymes Not I (for making in-frame, 12-amino acid insertion mutants) and Bsg I (for making 4-amino acid block substitution mutants). In order to use these sites for mutagenesis, the target construct must not contain recognition sites for Not I or Bsg I. For more information on design of suitable alternative viral end substrates see note [1] in the appendix.

This oligonucleotide substrate for MLV IN is made by annealing two oligonucleotides:
MLVNotBsgB 5'-AATGAAAGCTGCACGCGGCCGCATTCTTAT-3'
MLVNotBsgG 5'-ATAAGAATGCGGCCGCGTGCAGCTTTCA-3'
A third insert-specific oligonucleotide is needed for PCR analysis of insertional mutants: 5'-GGCCGCGTGCAGCTTTCA-3'.

4.) Commercially available enzymes: restriction enzyme(s) used for mutagenesis (e.g., Not I, Bsg I), T4 DNA ligase, T4 polynucleotide kinase. All enzymes were obtained from New England Biolabs.

5.) PCR Thermal Cycler and PCR consumables. We use a Perkin-Elmer 9600 thermal cycler with thin-walled 0.2 ml tubes, and AmpliTaq polymerase from Perkin-Elmer.

6.) Materials for preparative agarose gel electrophoresis. We use the Quiaquick gel extraction kit (Qiagen) for all band excision steps, and the Quiaquick PCR purification kit (Qiagen) for removal of enzyme when gel purification is not required.

7.) Materials for denaturing polyacrylamide sequencing gel electrophoresis.

8.) PCR primers complementary to the sequence being mutagenized. A good rule of thumb is one primer for every 200 nucleotides to be footprinted. We aim for a primer Tm of near 72 C, so that PCRs can be done by two step cycling (without an annealing step).

9.) Radioisotopes. Detection of footprinting PCR products is done by end-labeling PCR primers with gamma-32P-ATP, and PCR products are sized by comparison to control sequencing ladders made with alpha-35S-ATP.

PURIFICATION OF MLV INTEGRASE

MATERIALS

pGEX3XMLVIN (in DH5alpha)
Luria Broth (LB): 10.5 L
five 6L flasks
50 mg/ml carbenicillin (10.5 ml)
IPTG (595 mg), Sigma
Various buffer components (make sure there is DTT, reduced glutathione, autoclaved 80% glycerol, protease inhibitors, etc.)
lysozyme
protease inhibitors: PMSF, pepstatin A, leupeptin, antipain, aprotinin
0.45 um syringe filters (about 15)
1 ml and 10 ml syringes
glutathione-agarose resin (attached through the sulfur, Sigma G4510)
G-15 Sephadex
Columns (I.D. 15 mm)
Connectors, tubing, gradient maker, stir-plate, peristaltic pump
Sterile 1.5 ml screw capped tubes, 1.5 ml microcentrifuge tubes, 0.5 ml tubes for aliquoting enzyme
10% SDS-PAGE gels (enough for approximately 30 lanes)
15% Acrylamide-urea gels (enough for approximately 50 lanes)
Coomassie stain (40% methanol/10% acetic acid/0.5% Coomassie Brilliant Blue), destain (40% methanol/10% acetic acid)
Bradford reagent for protein assays (Biorad)
Sonicator
SW28 rotor, ultracentrifuge
ice, liquid nitrogen, -80°C freezer

BUFFERS AND SOLUTIONS

NB: Use autoclaved stock solutions of Tris, EDTA, NaCl, Glycerol, and Hepes.
Just before use, add DTT, reduced glutathione, and protease inhibitors where indicated, then pass through 0.2 um filter.

100 mM IPTG stock solution (MW=238.3)
595 mg IPTG
25 ml water

TEN Buffer, 1 liter final volume
(final concentration, amount of stock added to make 1 L solution)
10 mM Tris pH 8.0, 10 ml of 1 M stock
1 mM EDTA pH 8.0, 2 ml of 0.5 M stock
100 mM NaCl, 20 ml of 5 M stock
water, 968 ml

Lysis Buffer, 250 ml final volume
(final concentration, amount of stock added to make 250 ml solution)
50 mM Tris pH 8.0, 12.5 ml of 1 M stock
10 mM EDTA, 5 ml of 0.5 M stock
140 mM NaCl, 7 ml of 5 M stock
10% glycerol, 31.25 ml of 80% stock
10 mM DTT, 385 mg
1 mM PMSF, 4.35 ml of 10 mg/ ml stock in ethanol
1 ug/ml pepstatin A, 250 ul of 1 mg/ml stock in methanol
10 ug/ml leupeptin, 250 ul of 10 mg/ml stock in water
1 ug/ml antipain, 25 ul of 10 mg/ml in water
1 ug/ml aprotinin, 25 ul of 10 mg/ml in water
water, 189.4 ml

Buffer A, 100 ml final volume
(final concentration, amount of stock added to make 100 ml solution)
50 mM Tris pH 7.5, 5 ml of 1 M stock
100 mM NaCl, 2 ml of 5 M
10% glycerol, 12.5 ml of 80% stock
0.5% NP-40, 5 ml of 10% stock
10 mM DTT, 154 mg
water, 75.5 ml

Buffer B, 100 ml final volume
(final concentration, amount of stock added to make 100 ml solution)
50 mM Tris pH 7.5, 5 ml of 1 M stock
100 mM NaCl, 2 ml of 5 M
10% glycerol, 12.5 ml of 80% stock
0.05% NP-40, 0.5 ml of 10% stock
10 mM DTT, 154 mg
water, 80.0 ml

Buffer C, 100 ml final volume
(final concentration, amount of stock added to make 100 ml solution)
50 mM Tris pH 7.5, 5 ml of 1 M stock
100 mM NaCl, 2 ml of 5 M
10% glycerol, 12.5 ml of 80% stock
0.05% NP-40, 0.5 ml of 10% stock
10 mM reduced glutathione, 155 mg
water, 80.0 ml

2X MLV IN Reaction Buffer, 1 ml final volume
40 mM MOPS pH7.2, 40 ul of 1 M stock
150 mM KCl, 150 ul of 1 M stock
20 mM DTT, 20 ul of 1 M stock
100 ug/ml Bovine serum albumin, 10 ul of 10 mg/ml stock
40% glycerol, 500 ul of 80% stock
water, 280 ul

DAY 1: Grow small-scale bacterial culture overnight.
[Total work time = few minutes]
250 ml LB + 250 ul of 50 mg/ml carbenicillin + a colony of pGEX3XMLVIN (in DH5alpha). Grow overnight at 37 C.

DAY 2: Large-scale growth and induction of Integrase expression, prepare viral substrate for activity assays, pour gels.
[Total work time = 11 hours or so. Hands on time = 5 hrs or so]
2L X 5 LB in 6L flasks warmed to 30 C.
Add 2 ml of 50 mg/ml carbenicillin/flask and 40 ml of overnight culture.
Grow with shaking (250 rpm) at 30 C till O.D.600 is 0.8 (takes around 6 - 6.5 hours).
Meanwhile, prepare viral substrate (see below), pour gels (see below), autoclave tubes.

Add 5 ml of 100 mM IPTG to each 2 L flask, when cultures reach O.D.600 of 0.8.
Grow for additional 3 hrs at 30 C.
Transfer to ice.

Spin down cells: Pour cultures into 6 X 1 L bottles that fit in Sorvall H6000A rotor. 4500 rpm for 30 min at 4 C. Discard supernatant. Refill same bottles with more cultures Repeat spin. Discard supernatant.
Wash pellet with TEN buffer. Resuspend each pellet in 20 ml TEN completely. Pool into two 250 ml centrifuge bottles. Bring final volume in each to 250 ml with TEN.
Spin at 6000 rpm for 10 min at 4 C.
Discard supernatant. Place bottles in -80 C (no liquid nitrogen).

Prepare viral substrate. This involves radiolabeling oligonucleotides and annealing them to generate viral DNA ends that can be used to assay activity of fractions from the column. We use oligonucleotides A194 (5'-ACCTACAGGTGGGGTCTTTCATT-3') and A193 (5'-AATGAAAGACCCCACCTGTAGGT-3') for measuring end processing and joining activities. Oligonucleotides used to measure disintegration activity are MLVDISIN-2 (5'-CGCAAGCGCC-3') and MLVDISIN-1 (5'AATGAAAGTTCTTTCAGGCCGCAGGTCTTGACCTGCGGCCGGCGCTTGCG-3').

Kinase oligonucleotide substrate, 100 ul final reaction volume
1 ul of 100 uM oligonucleotide A194 or MLVDISIN-2 (100 pmol oligonucleotide)
10 ul gamma-32P-ATP (100 uCi)
10 ul 10X kinase buffer
5 ul T4 polynucleotide kinase (50 U) [New England Biolabs]
74 ul water
Incubate 37 C for 1 hr. Incubate 65 C for 20 min to heat inactivate kinase.
Run over a G-15 Sephadex spin column to get rid of free label.

Anneal to unlabeled second oligonucleotide:
all of above labeled oligonucleotide
+ 1 ul 100 uM second oligonucleotide
+11 ul 500 mM NaCl
Heat to 95 C for 2 min. Cool over 1 hr to 20 C.
Store shielded at 4 C.

Pour SDS-PAGE gels.

30% Acrylamide (37:1)

4X Resolving Gel Buffer
1.5 M Tris, 18.17 g
0.4% SDS, 4 ml of 10%
Water, qs to 100 ml
pH to 8.8 with HCl
Filter

4X Stacking Gel Buffer
0.5 M Tris, 6.06 g
0.4% SDS, 4 ml of 10%
Water, qs to 100 ml
pH to 6.8 with HCl
Filter

6X Protein Sample buffer
4X Stacking Gel Buffer, 7 ml
Glycerol, 4.5 ml of 80%
SDS, 1 g
DTT, 0.93 g
Bromophenol Blue, 1.2 mg
Water, qs to 10 ml
Filter
Store at -20 C

5X SDS Running Buffer
Tris Base, 15.1 g
Glycine, 72 g
SDS, 5 g
Water, qs to 1000 ml

Stain
10% Acetic Acid
20% Methanol
0.5% Coomassie Brilliant Blue
Filter

Fix/Destain
10% Acetic Acid
20% Methanol

Resolving Gel
4X Resolving Gel Buffer, 4.0 ml
30% Acrylamide, 5.3 ml
Water, 6.7 ml
10% APS, 80 ul
TEMED, 15 ul

Stacking Gel
4X Stacking Gel Buffer, 2.5 ml
30% Acrylamide, 1.5 ml
Water, 6.0 ml
10% APS, 30 ul
TEMED, 30 ul

Pour Acrylamide-urea Sequencing gels.
Glycerol-tolerant (TTE) gel running buffer is used because MLV IN reaction buffer contains 20% glycerol.

20X TTE buffer
Tris Base, 216 g
Taurine, 72 g
EDTA disodium salt, 4 g
qs to 1 liter, filter

15% denaturing sequencing gel (per 1 gel, with extra for spillage)
urea, 42 g
20X TTE, 5 ml
40% acrylamide (19:1), 37.5 ml
water, qs to 100 ml
Microwave 30 sec and stir to dissolve urea, 0.45 um filter. Prepare sequencing gel plates while mix is cooling. To initiate polymerization, add 400 ul of 10% ammonium persulfate and 60 ul of TEMED.

DAY 3: Lysis of cells, glutathione-agarose (GA) column.
[Total work time = all day and night (the column needs babysitting). Hands on time: several hours.]
Lysis of cells
Resuspend cells in 200 ml Lysis Buffer.
Add lysozyme to 1 mg/ml.
Ice 1 hr.
Aliquot into 50 ml Falcon tubes (~40 ml/tube).
Freeze in liquid nitrogen/thaw in 37 C water bath. Invert tubes periodically while thawing. Freeze/thaw three times.
Sonicate 5 x 30 sec, full power, medium tip (tip diameter 6 mm), on ice, moving the tube up and down.
Spin at 105,000 x g 30 min in SW28 rotor (24,000 rpm). Toss pellet.
Filter supernatant through 0.45 um syringe filters.
Add NP-40 to 0.5%.

Swelling and Equilibrating Glutathione-agarose column
Swell 425 mg glutathione-agarose in Buffer A (85 mg dry powder swells to approximately 1 ml column volume)
Transfer swelled resin into column.
Wash with 50 ml (10 volumes) of Buffer A.

Running Glutathione-agarose column
NB: Column is run entirely by gravity
Load the cleared and filtered cell lysate onto equilibrated column. This will take about 10-12 hours. Save the flow.
Wash with 50 ml (10 volumes) Buffer B.
Elute with 30 ml (6 volumes) Buffer C. Collect 1.5 ml fractions (20 fractions).

Bradford Assays
Dilute concentrated Bradford reagent 1:5 with water. Filter through 0.45 um.
Aliquot 1 ml diluted reagent per sample.
Make up quantitation standards (0, 1, 2, 4, 8, 16 ug BSA).
Assay 5 ul of each fraction.
Protein peak is usually seen in fractions 5-8.

SDS/PAGE of protein fractions
Run ~5 ug of load, flow, wash, and each fraction. Stain with Coomassie. Destain. GST-Integrase runs around 72 kD and free GST at 26 kD.

DAY 4: Activity assays on fractions from the GA column, aliquot.

Activity Assays on Fractions.
Assemble two master mixes (one each for integration and disintegration substrates) with the appropriate multiple of the following components.

2X MLV IN buffer, 5 ul
50 mM MnCl2, 1 ul
labeled substrate, 1 ul (0.5 - 1 pmol)
water, 2 ul

Aliquot 9 ul of mix to each tube (remember to include a no enzyme control). Add 1 ul of fraction and pipet up and down to mix. Incubate at 37 C for 30 min While reactions are incubating, prerun 15% denaturing polyacrylamide gel (65 W for 30 min). To stop reactions and denature products, add 10 ul of formamide loading dye (95% deionized formamide, 20 mM ETDA, 0.05% xylene cyanol, 0.05% bromophenol blue). Heat samples to 90 C for 3 min and load 5-10 ul per lane on prewarmed gel. Run gel for 2 hours at 65 W. Remove gel from plate and cover both sides with Saran Wrap. Mark the orientation of the gel, and expose wet gel to Kodak XAR-5 film for 1-2 hours at -40 C.

For the disintegration reaction, the expected product is larger than the starting material and thus easily distinguished from potential nuclease contaminants. The peak of integrase activity is typically in fractions 4-6. For photographs of activity assay gels, see Dotan et al. J. Virology 69(1): 456-468.

GENERATION OF INSERTIONAL MUTANTS

MATERIALS REQUIRED FOR INTEGRATION REACTIONS

MLV Integrase (MLV IN). See attached enzyme purification protocol.

Viral end oligonucleotide duplex substrate:
(Sequence can be varied depending on features desired - see note [1] of the appendix for information on designing appropriate alternative viral end oligonucleotides.) The sequence of our oligonucleotide duplex of choice is shown below.
MLVNotBsgB 5'-AATGAAAGCTGCACGCGGCCGCATTCTTAT-3'
MLVNotBsgG 5'-ATAAGAATGCGGCCGCGTGCAGCTTTCA-3'

Plasmid containing target gene (1 mg/ml)
DNA must have a minimal amount of nicked circle present in prep. We routinely use Qiagen maxiprep DNA for integration target.

2X MLV IN buffer (Store in aliquots at -20 °C)
40 mM MOPS pH7.2, 40 ul of 1 M stock
150 mM KCl, 150 ul of 1 M stock
20 mM DTT, 20 ul of 1 M stock
100 ug/ml Bovine serum albumin, 10 ul of 10 mg/ml stock
40% glycerol, 500 ul of 80% stock
water, 280 ul

50 mM MnCl2

4 M NaCl

5X Integration Stop buffer (Store in aliquots at room temp)
15% Ficoll (Type 400; Pharmacia)
2.5% SDS
50 mM disodium EDTA
0.25 % Bromophenol Blue
0.25 % Xylene Cyanol

10X Proteinase K stock (Store in aliquots at -20 °C)
10 mM Tris
500 ug/ml Proteinase K (Boehringer Mannheim)
Boil for 10 minutes to destroy any nuclease contaminants, allow to cool to room temperature.

MATERIALS REQUIRED FOR PCR (Store solutions in aliquots at -20 °C)

10X PCR buffer
200 mM Tris-HCl (pH 8.55 at 25 C)
160 mM (NH4)2SO4
1.5 mg/ml bovine serum albumin
(Nonacetylated BSA, New England Biolabs)

100x dNTP stock, 25 mM in each dNTP (Pharmacia)

35 mM MgCl2

AmpliTaq DNA polymerase (Perkin-Elmer)

OTHER MATERIALS REQUIRED

Not I restriction enzyme (New England Biolabs)

T4 DNA ligase (New England Biolabs)

Quiaquick Gel extraction kit (Quiagen)

Quiaquick PCR purification kit (Quiagen)

BEFORE STARTING THIS PROTOCOL, PLEASE SEE APPENDIX FOR DETAILED NOTES ON INDIVIDUAL STEPS. NOTES ARE REFERENCED THROUGHOUT THE PROTOCOL BY BRACKETED NUMBERS, e.g., [1], [2], etc.

1) INTEGRATE INTO PLASMID CONTAINING TARGET GENE

Anneal viral-end oligonucleotides:

1 ul (100 pmol) MLVNotBsgG
1 ul (100 pmol) MLVNotBsgB
2 ul 500 mM NaCl
qs to 20 ul with TE buffer (10 mM Tris pH 8, 1 mM disodium EDTA)
Heat to 95°C for 5 min, cool slowly to room temperature.
Add 80 ul of TE buffer
(Final concentration of annealed oligonucleotide= 1 pmol/ul = 1 uM)

Form stable complex between integrase and viral end oligonucleotide:

50 ul 2X MLV IN buffer
10 ul 50 mM MnCl2
8 ul annealed viral end oligonucleotide (8. pmol)
ul MLV integrase (12 pmol) - volume is variable
qs to final volume of 85.5 ul.
Incubate for 5 min at 37°C to form stable complex between integrase and viral end oligonucleotide.

Integrate into target DNA:
To above mixture, add 10 ul of 4 M NaCl, and 4.5 ul of target plasmid DNA, mix. Incubate at 37 C for 30 min

Stop integration and deproteinize reaction intermediates:
Add 25 ul of integration stop buffer, and 13 ul of proteinase K stock solution. Incubate at 37 C for 30 minutes.

2) GEL PURIFY CONCERTED INTEGRATION PRODUCT
See note [2] in the appendix.

Prepare linearized target plasmid DNA, to be used as a size standard in gel purification of concerted integration product. To minimize aberrations in electrophoresis due to high salt in the integration samples, after digestion increase the salt concentration of the linear size standard to equal that of the integration reaction (0.4 M NaCl).

Cast a 1% preparative agarose gel, approximately 14 cm long. We use SeaKem LE Agarose (FMC), 1X TBE gel running buffer. Load the integration product adjacent to the linearized and uncut size standards. The gel is run at 4-5 V/cm (based on interelectrode distance), until the expected product band is approximately 2/3 through the gel.

Stain gel briefly with ethidium bromide. The concerted integration product should run slightly above the linearized size standard, as the two integrated viral end oligonucleotides make it larger than linearized plasmid by 56 bp. Carefully cut the region of the gel containing the concerted integration product, which migrates between the linearized plasmid and the nicked circle. Be careful to avoid the nicked circle.

Extract the DNA from the gel slice using the Qiaquick gel extraction protocol, according to manufacturer's instructions (Qiagen). Elute DNA in 50 ul of 10 mM Tris.

3) PCR AMPLIFY CONCERTED INTEGRATION PRODUCT
See notes [3] - [5] in appendix.

10 ul 10X PCR buffer
10 ul 35 MgCl2
1 ul dNTP mixture
4 ul primer MLVNotBsgG (40 pmol)
1 ul template (Qiaquick purified concerted integration product)
0.5 ul Amplitaq (2.5 U)
ul water - volume is variable
final volume 100 ul

Thermocycling Conditions
5 min at 72 C (strand displacement synthesis)
2 min at 94 C
followed by 20-40 cycles of
30 sec at 94 C
1-2 min at 72 C (1 min sufficient for amplification of 2 kb product)

Once the optimal conditions for PCR amplification of the concerted integration product have been determined, the PCR reaction should be scaled up approximately 10-fold to obtain ample amounts of this product for subcloning.

If the concerted integration PCR product appears as a single clean band of expected size on an ethidium-stained agarose gel, the product can be purified over Qiaquick PCR purification column (Qiagen). A single column can be loaded many times in order to concentrate the sample.

If the concerted integration PCR product has a small amount of smearing, the PCR product should be gel purified using the Qiaquick gel extraction kit as described above.

4) RESTRICTION ENDONUCLEASE DIGESTION OF CONCERTED INTEGRATION PRODUCT

Estimate the concentration of the purified PCR product by minigel.
Digest PCR product with 20-fold excess of enzyme units per ug DNA. Overnight digestion in manufacturer-supplied buffer (New England Biolabs) is recommended for end-cutting, unless the enzyme is known to be relatively impure, as is the case for type IIS endonucleases. Remove restriction enzyme and change to ligase buffer either by (1) extraction with phenol: chloroform: isoamyl alcohol and precipitation with ethanol or (2) purification over Qiaquick PCR purification column.

5) LIGATE TO RECIRCULARIZE INSERTIONAL MUTANTS

Estimate the concentration of purified DNA by minigel. To promote intramolecular rather than intermolecular events, ligations are performed at a dilute DNA concentration. The desired DNA concentration can be determined from the following formula: y = [1900 / c * (bp)exp0.5], where c is the concentration of DNA in ng/ul, and bp is the length of the DNA in basepairs. Intramolecular ligation is favored when c is chosen such that y>>1. We have found that y values of 10 give a good transformation efficiency. To obtain maximum transformation efficiency, set up a few test ligations with different DNA concentrations.

Ligation Reaction (100 ul final volume)
10 ul 10X T4 ligase buffer (New England Biolabs)
ul purified, restriction-digested PCR product (50-100 ng) - volume is variable
1 ul T4 DNA ligase (12.5 Weiss units - New England Biolabs)

Incubate ligation for 12-18 hours at 16 C. Heat inactivate ligations at 65 C for 10 minutes.

Transform/transfect mutants and subject to appropriate selections. Prepare DNA corresponding to the populations of mutants with and without selection for the gene that has been mutagenized. NB: Efficiency of transformation can be increased by phenol:chloroform extraction and ethanol precipitation of ligations prior to transformation.

GENERATION OF SUBSTITUTION MUTANTS

See notes [6] - [8] in appendix.

NB: This protocol for making 4-amino acid block substitution mutants requires that the replacement oligonucleotide contain a unique restriction site. An alternative protocol for making substitution mutants, which does not require the presence of a unique site within the replacement oligonucleotide, is being developed and will be made available at this site at a later date.

MATERIALS

Insertional mutant library, made as described in the section "Generation of Insertional Mutants." Grow plasmid DNA corresponding to the insertional mutant library that is unselected with respect to your gene of interest.

Replacement oligonucleotide of desired sequence.
The replacement used for supF was designed to add a unique Nde I restriction site. The sequence of this self-complementary oligonucleotide is 5'-TAGCATATGCTANN, where N represents an equal mixture of the four deoxynucleotides.

Enzymes and buffers (New England Biolabs):
Bsg I restriction endonuclease - supplied with S-adenosylmethionine
NdeI restriction endonuclease
T4 Polynucleotide Kinase
T4 DNA ligase

ATP stock solution (10 mM)

1) DIGEST INSERTIONAL MUTANT LIBRARY WITH BSG I

15 ul 10X New England Biolabs restriction buffer 4
0.4 ul S-adenosylmethionine (32 mM stock, New England Biolabs)
ul 3 ug DNA, unselected insertional mutant library - volume is variable
13 ul Bsg I enzyme (20 U, New England Biolabs)
qs to 150 ul final volume.

Incubate digest at 37 C for 1-2 hours, adding 0.4 ul of S-adenosylmethionine to the reaction every 20 minutes. Longer digestion times are not recommended because the Bsg I enzyme is relatively impure. Heat inactivate digest at 65 C for 20 minutes. Extract with phenol:chloroform:isoamyl alcohol and precipitate with ethanol.

To achieve complete digestion with Bsg I, a second identical round of Bsg I digestion and phenol:chloroform extraction is needed.

2) SELF-ANNEAL REPLACEMENT OLIGONUCLEOTIDE

2 ul replacement oligonucleotide (200 pmol)
16 ul TE buffer
2 ul 500 mM NaCl

Heat to 95 C for 5 min, and cool slowly to room temperature. Final conc. of annealed oligonucleotide is 5 uM.

3) LIGATE PLASMID TO REPLACEMENT OLIGONUCLEOTIDE

5 ul 10X T4 ligase buffer
ul Bsg I-digested library DNA (500 ng=approx. 0.5 pmol) - volume is variable
8.0 ul kinased, annealed replacement oligonucleotide (40-50 pmol)
1 ul T4 ligase (12 Weiss units, New England Biolabs)
50 ul final reaction volume

Incubate ligation at 16 C for 18 hours. Heat inactivate ligase 65 C for 10 minutes. Extract ligation with phenol:chloroform:isoamyl alcohol and precipitate with ethanol.

4) FILL IN WITH TAQ POLYMERASE

10 ul 10x PCR buffer
10 ul 35 mM MgCl2
1 ul 100x dNTPs stock
78.5 ul ligated DNA
0.5 ul Amplitaq polymerase

Final volume 100 ul. Incubate 10 minutes at 72 C to fill in.
Purify reaction product either by Quiaquick PCR purification kit or by phenol:chloroform followed by ethanol precipitation.

5) DIGEST LIGATION PRODUCTS WITH NDE I

20 ul 10 X NEB buffer 4
ul phenol-extracted, ligated DNA - volume is variable
5 ul Nde I enzyme (100 U)
200 ul final volume.

Incubate at 37 C for 30 min to 1 hour (half-life of Nde I enzyme is 15 minutes at 37 C.) After digestion, cleaved excess oligonucleotide was removed with Qiaquick PCR purification kit (Qiagen).

5) RECIRCULARIZE MOLECULES BY LIGATION

Estimate concentration of purified DNA by minigel. To determine the proper DNA concentration for ligations, refer to the formula in the "Generation of Insertional Mutants" section, under step (5) "Ligate to recircularize insertional mutants."

Ligation Reaction (100 ul final volume)
10 ul 10X T4 ligase buffer (New England Biolabs)
ul purified, restriction-digested DNA (50-100 ng DNA)
1 ul T4 DNA ligase (12.5 Weiss units - New England Biolabs)

Incubate ligation for 12 hours at 16 C. Heat inactivate ligation for 10 minutes at 65 C.

Transform/transfect mutants and subject to appropriate selections. Prepare DNA corresponding to the populations of mutants with and without selection for the gene that has been mutagenized.

ANALYSIS OF INSERTIONAL MUTANTS BY PCR FROM INSERT

See note [9] in appendix.

MATERIALS

T4 polynucleotide kinase (New England Biolabs)

Sephadex G-15 resin (swell in TE buffer), glass wool, 1 ml syringes (for making spin columns)

Gene-specific primer(s). We typically select two primers, one for each template strand, for every 200 bases to be analyzed. Primers are designed to have annealing temperatures in the range of 65-72 C to reduce nonspecific priming in the PCR.

Insert-specific primer
For mutants generated with the MLVNotBsgG/B, the insert-specific primer is shMLVNotBsg (5'-GGCCGCGTGCAGCTTTCA).

Radioisotopes.
gamma-32P-ATP (10 uCi/ul), for end-labeling PCR primers
alpha-35S-ATP, for making control sequencing ladders, which are used as size standards for footprinting PCR products. (Also need reagents for making sequencing ladders).

PCR Reagents -- see Materials section within "Generation of Insertional Mutants"

MATERIALS FOR DENATURING POLYACRYLAMIDE GEL ELECTROPHORESIS

Urea

40% Acrylamide (19:1)

Formamide gel loading dye
95% v/v deionized formamide
20 mM EDTA
0.05% w/v xylene cyanol
0.05% w/v bromophenol blue

20X TTE=Glycerol-Tolerant Gel Running Buffer
note: traditional TBE buffer can also be used for this type of analysis gel.
216 g Trizma
72 g Taurine
4 g disodium EDTA (2 H2O)
qs to 1 liter

1) LABEL GENE-SPECIFIC PRIMER WITH 32P

10 ul 10X T4 Polynucleotide Kinase buffer (New England Biolabs)
1 ul gene-specific primer (100 pmol)
10 ul (100 uCi) gamma-[32P]-ATP (3000 Ci/mmol)
5 ul (50 U) T4 Polynucleotide Kinase Enzyme (New England Biolabs)
qs to 100 ul

Incubate kinase reaction at 37 C for 1 hour. Heat inactivate kinase at 65 C for 20 min. Purify labeled oligonucleotide away from unincorporated label by spin column chromatography through a 1 ml bed of Sephadex G-15 (Pharmacia). Specific activity should be approximately 800,000 cpm per pmol of oligonucleotide.

2) PCR ANALYSIS OF MUTANT LIBRARIES

2 ul 10X PCR buffer
2 ul 10X MgCl2 (20 mM for shMLVNotBsg)
0.4 ul insert primer (shMLVNotBsg, 10 uM stock)
0.3 ul gene-specific primer (10 uM stock)
ul 32P-labeled gene-specific primer (1.0 pmol)
ul template DNA (approx. 20 ng)
0.1 ul AmpliTaq (0.5 U)
in a 20 ul final reaction volume

Thermocycling conditions
2 min at 94 C
followed by 15-20 cycles of
30 sec at 94 C
20 sec at 68 C (annealing temp varies)
30 sec at 72 C

3) DENATURING POLYACRYLAMIDE GEL ANALYSIS OF PCR PRODUCTS

Add 20 ul of formamide gel loading dye to PCR reactions. Heat samples to 95 C for 3 min before loading onto a prewarmed 6% or 8% polyacrylamide sequencing gel, containing 7 M urea and 1X TBE (or 1X TTE) running buffer. Bands are sharper if 1X TBE is used, but the glycerol-tolerant buffer 1XTTE must be used if also analyzing mutants by the restriction endonuclease method described below. A 35S-sequencing ladder made with the same template and gene-specific primer combination serves as an appropriate molecular weight marker for footprinting lanes. Gels are run at approximately 70 W for 2-6 hours.

ANALYSIS OF INSERTION OR REPLACEMENT MUTANTS BY RESTRICTION ENDONUCLEASE METHOD

See notes [10] and [11] in appendix.

MATERIALS
-- See "MATERIALS" section under Analysis of Insertional Mutants by PCR from insert

SSAM PCR purification kit ,Clontech (K1105-1)

1) AMPLIFY REGION OF INTEREST WITH TWO GENE-SPECIFIC PRIMERS, ONE OF WHICH IS LABELED WITH 32P.

4 ul 10X PCR buffer
4 ul 10X MgCl2
0.4 ul dNTP stock
ul primer 1 (4 pmol, kinased with 32P)
ul primer 2 (4 pmol, cold)
ul template DNA (20 ng)
0.2 ul AmpliTaq polymerase (1.0 U)
qs to 40 ul

Suggested Thermocycling Conditions

2 min at 94 C
followed by 15-20 cycles of
30 sec at 94 C
20 sec at 68 C
30 sec at 72 C

Optimal annealing temperature and extension time will vary depending on the primers being used, and the length of the product being amplified. We typically use a 30 sec extension for products that are 300-500 bp in length.

2) PURIFY RADIOACTIVE PCR PRODUCT WITH SSAM SINGLE-STRAND DNA BINDING RESIN.

To 40 ul PCR reaction, add 7 ul of 8 M LiCl2, to bring final salt concentration to >1 M. Add 15 ul of SSAM slurry. Incubate 10 minutes at room temperature, flicking the tube every 2 minutes to resuspend the SSAM. Pipet the SSAM and PCR reaction into the spin filter provided in the SSAM kit. Spin 1 minute in tabletop microfuge at 3000 rpm to remove SSAM resin.

To desalt the reaction, purify the SSAM eluate by precipitation with ethanol or by using the Quiaquick PCR purification kit (Qiagen). Elute DNA in 30 ul water.

3) DIGEST PCR PRODUCT WITH ENZYME UNIQUE TO REPLACEMENT

Example Nde I digest
2 ul 10X NEB buffer 4
16.5 ul SSAM / QQ purified PCR product
1.5 ul Nde I enzyme (30 U)

Incubate digest at 37 C for 1 hour.

4) ANALYZE RESTRICTION FRAGMENTS ON DENATURING POLYACRYLAMIDE GEL.

Add to digest an equal volume of formamide gel loading dye. Heat samples to 95 C for 3 min before loading onto a 6% or 8% polyacrylamide sequencing gel, containing 7 M urea and 1X TTE, glycerol-tolerant gel running buffer. A 35S-sequencing ladder made with the same template and gene-specific primer combination serves as an appropriate molecular weight marker for footprinting lanes. Gels are run at approximately 70 W for 2-6 hours.

APPENDIX

[1] Design of integration oligonucleotides:

The sequence of the viral end oligonucleotide substrates used for genetic footprinting is dictated by three factors: (a) the conserved sequence required by MLV integrase to recognize a viral DNA end, (b) the sequence of one or more restriction sites that will be used for the mutagenesis, and (c) the features desired in the mutation.
(a) Minimal requirements for functional MLV viral end:
For analysis of tolerated mutations of the MLV viral end, consult the following papers (and references therein)
Balakrishnan and Jonsson (1997) J. Virology 71(2): 1025-1035.
Murphy and Goff (1993) Virology 195: 432-440.
Bushman and Craigie (1990) J. Virology 64(11): 5645-5648.
(b) The sequence and placement of restriction sites within the viral end oligonucleotide: The Not I restriction site was placed within the viral end oligonucleotide such that after restriction enzyme cleavage and religation, the insertion would maintain amino acid reading frame. In addition, because the MLV integrase enzyme attacks target DNA with a four-base pair stagger, integrated sequences are flanked by a duplication of four host nucleotides. This four-base duplication must be taken into account when designing an insertion that will maintain reading frame. For example, cleavage with Not I and recircularization for the MLVNotBsgB/G substrate generates a 36-base insertion of sequence
5'-TGAAAGCTGCACGCGGCCGCGTGCAGCTTTCANNNN-3', where NNNN represents the four-base duplication.
(c) Features desired in the mutation. Depending on the position of the insertion within the gene, the insertion can be read in any of the three possible amino acid reading frames. If the target of interest is a protein-coding gene, it may be desirable to eliminate stop codons from all three reading frames of the insertion. (Note that the wild type MLV viral end does contain the stop codon 5'-TGA-3' in one of the three reading frames.)

[2] Gel purification of the concerted integration product:

Gel purification is used to separate plasmids that have undergone concerted integration, and are therefore linear, from those that have only a single oligonucleotide integrated (nicked circle), and those that have no oligonucleotide integrated (supercoiled). THIS IS THE MOST CRITICAL STEP OF THE GENETIC FOOTPRINTING PROTOCOL. The concerted integration product may not be abundant enough to be seen on an ethidium-stained gel, but the product can be cut blindly from the gel, based on the position of uncut and linear size standards made from the target plasmid. During band isolation it is essential to avoid contaminating the linear concerted integration product with any of the nicked circular (i.e., single-oligonucleotide integration) product. Contamination with the nicked product will prevent clean PCR amplification of the concerted integration product in the next step of the procedure (see Appendix note [6] for further discussion of PCR of concerted integration products).

[3] Rationale for strand-displacement synthesis and PCR amplification of concerted integration product:

Concerted integration by MLV integrase generates a four nucleotide gap flanking the integrated oligonucleotides. This gap is filled in by strand displacement synthesis with Taq polymerase. The resulting molecules are amplified by PCR using one of the viral end oligonucleotides, both to obtain more starting material, and to further select for molecules that have undergone a concerted integration of two oligonucleotides.
For all PCR reactions, the Perkin-Elmer 9600 thermal cycler was used, with ramp times set to zero. Reactions were assembled on ice in 0.2 ul Micro-Amp tubes (Perkin-Elmer). Aerosol (filter barrier) pipet tips were used when working with PCR reagents.

[4] Optimization of concerted integration PCR - MgCl2 concentration:

The concentration of MgCl2 must be optimized for each primer, with 0.5 - 6.5 mM being the typical range of final concentrations. 3.5 mM MgCl2 was the final concentration used for MLVNotBsgG, and is a good starting point for many other primers.

[5] Optimization of concerted integration PCR:

Due to variable recovery during gel purification of the concerted integration product, it is necessary to optimize the number of cycles needed to amplify the concerted integration product from every new integration reaction. Increments of 2-4 cycles should be used to determine the optimal number of cycles needed to obtain a clean PCR product. The optimal PCR product should be a single band that is slightly larger than the linearized target plasmid.

The complex template of the concerted integration PCR can lead to PCR artefacts. For the concerted integration PCR, performing too many cycles of PCR has been observed to generate a ladder of lower molecular weight bands, or a smear, rather than a saturation of the specific PCR product. Smearing has also been observed when attempting to amplify large (> 3 kb) target molecules by the concerted integration PCR. Smearing is believed to occur because the concerted integration template is circularly permuted. That is, because integration occurs at different sites in each target molecule, the viral end priming site is adjacent to a different region of the target DNA in each template molecule. PCR products that are incompletely extended in one cycle of PCR can reanneal to a complementary region in a different molecule in the next cycle, to form a spurious product that is either smaller or larger than the expected product size. DNA template molecules that are nicked will contribute to the formation of incompletely extended PCR products; therefore, it is important to use supercoiled DNA as the integration target when beginning Genetic Footprinting. The increased difficulty in amplifying larger target molecules in the concerted integration PCR is presumed to be due to the increased likelihood of premature termination during PCR across longer templates. The mutagenesis of larger target molecules by Genetic Footprinting will therefore require elimination of the concerted integration PCR. We are in the process of developing protocols for mutagenesis with MuA transposase, which performs concerted integration much more efficiently than MLV integrase, and should therefore obviate the need for the concerted integration PCR.

Concerted integration products that consistently give rise to a smear or a ladder of bands of various sizes are usually the result of contamination with the nicked integration product during gel extraction. If a fairly clean PCR band cannot be obtained by varying the cycle number (and MgCl2 concentration and annealing temperature if using a primer other than MLVNotBsgG), it is best to repeat the integration and gel purification of the concerted product. A minimal amount of smearing in the concerted integration PCR product can be tolerated, provided that the desired PCR product is gel purified.

[6] Introduction to construction of substitution mutants and limitations of existing protocols:

To remove the 36 bp insertion sequence and to generate a net deletion of 12 bp of flanking DNA, the insertion library is digested with Bsg I, a type IIS restriction enzyme. The 12 bp deleted by Bsg I is then replaced with by ligating the digested plasmid to a double-stranded "replacement oligonucleotide" of any desired sequence. At this time, our protocols for construction and analysis of substitution mutants are limited to replacement oligonucleotides that are palindromic and contain a unique restriction site. Protocols for creation and analysis of replacement mutants of truly arbitrary sequence (i.e., independent of the presence of a restriction site in the replacement oligonucleotide) are under development and will be made available at this site at a later date.

[7] Rationale for design of the replacement oligonucleotide:

To facilitate construction and analysis of mutants, the replacement oligonucleotide was designed to be self-complementary, and to contain a unique Nde I restriction site. The replacement oligonucleotide contains a 2 base randomized 3' overhang, designed to be complementary with the unspecified 2 base, 3' overhang generated by Bsg I digestion of the plasmid DNA.

[8] Rationale for ligation to replacement oligonucleotide:

The replacement oligonucleotide contains a 2 base randomized 3' overhang. In order to increase the likelihood that each unspecified overhang of the plasmid will find the correct partner from the randomized pool, the replacement oligonucleotide is present at a 100-fold molar excess over plasmid DNA in the ligation. This results in the ligation of two replacement oligonucleotides per molecule of plasmid DNA (multimers cannot be formed because the replacement oligonucleotide is unphosphorylated.) The ligation product is filled in with Taq, and then digested with the restriction enzyme that cuts in the replacement oligonucleotide (e.g., Nde I), to leave a net stoichiometry of one oligonucleotide per plasmid. The excess cleaved oligonucleotide is removed, and the linearized plasmid molecules are recircularized by a second ligation.

[9] Rationale for analysis of insertional mutants by PCR from insert:

DNA from the unselected and selected libraries of mutants is used as template for a PCR that uses one-half of the insert oligonucleotide as one of the priming sites and a radiolabeled primer complementary to the gene as the second priming site. Radioactive PCR products are resolved on a denaturing polyacrylamide sequencing gel.

[10] Rationale for analysis of insertional or replacement mutants by restriction endonuclease digestion of PCR products:

Because the replacement oligonucleotide is too short to serve as a specific PCR primer, block substitution mutant libraries are analyzed by an alternative method. This method of analysis is also used for short insertional mutants.

PCR is performed on unselected and selected library DNA, using two gene-specific primers that flank the region of interest in the target DNA, with one of the two primers radiolabeled. The full-length radiolabeled PCR product is then purified away from incomplete extension products with SSAM single-stranded DNA binding resin (Clontech), followed by Quiaquick PCR purification kit (Quiagen). The purified PCR product is then digested with the restriction enzyme whose recognition site is unique to the replacement oligonucleotide, to generate a ladder of products of varying lengths. Analysis of insertional mutants by PCR from insert and by the restriction endonuclease method demonstrates that these two methods of analysis, when applied to the same templates, yield equivalent footprinting data (Singh, Crowley and Brown (1997) PNAS 94: 1304-1309).

If the replacement oligonucleotide does not contain a restriction site, mutants must be analyzed by an alternative method such as primer extension. Protocols for analysis of substitution mutants of arbitrary sequence are under development and will be posted at this site at a later date.

[11] Rationale for SSAM treatment before restriction digestion of PCR products:

If the untreated, uncut radioactive PCR product is run on a denaturing gel, a ladder of incomplete extension products is visible in addition to the expected full-length PCR product. In order to remove the incomplete extension products, the PCR reaction is purified with SSAM, which binds selectively to DNAs that are completely or partially single-stranded, but not to dsDNA. As the SSAM binding requires high salt, the SSAM-treated PCR product must be subsequently ethanol precipitated or run over a desalting column prior to restriction endonuclease cleavage.

HIGH RESOLUTION GENETIC FOOTPRINTING HOME PAGE