Telomere length can vary from strain to strain and is sensitive to a variety of mutants affecting DNA and chromosome function. This protocol is derived from published work by Julie Cooper and used by Eliana Gomez in our lab.
1- Grow cells for ca. 100 generations (we have done it for approx 50 taking into account that they had already been through several generations before we did the experiment).
2- Prepare genomic DNA using standard protocols (see Moreno et al; , or the Nurse Lab Handbook).
3- Digest gDNA with EcoRI (ApaI is also used but we've had less success with it)
4- Run digested DNA on 1 % agarose gel, 1 X TBE.
5- Probe with Telomeric oligo probe (5' GGGTTACAGGTTACAGGTTACA 3')
controls:
WT strains have a smear between 900 and 1100 bp.
taz1 strains have really long telomeres, with the smear very much higher
rhp51 will get slightly longer (above 1100 bp)
rad2 has slightly shorter telomeres.
1. Digest 15ug of genomic DNA overnight.
2. Run digested DNA in a 1% agarose 1 x TBE.
3. Soak gel in 0.25 N NCl for 10-15 min.
4. Rinse gel with dH2O
5. Soak gel in 0.4 N NaOH for 30 min
6. Wet membrane (I used NEN GeneScreen Plus) with dH2O
7. Equilibrate membrane in 0.4 N NaOH for 15 min
8. Set up a capillary blot using 0.4 N NaOH (I left transferring for 18 hr)
9. Rinse membrane in 2 X SSC
10. Cross link DNA to membrane using Stratalinker (you can keep membrane wet at 4°C in sealed bag till hybridization)
11. Prehybridize membrane at 42°C with approx 10 ml Prehyb solution (make sure that the membrane is completely covered) for a minimum of 2hrs. You should add the DNASSS (Sonicated salmon sperm DNA) once the Prehyb solution reaches 42°C.
12. Before adding the labeled probe change the Prehyb solution for the Hybridization solution. Wait till Hyb Solution reaches to 42°C and add the labeled oligo. Incubate ON at 42°C.
13. Wash membrane 2 x with 20 ml 6x SSC/0.1% SDS at room temp.
14. I washed membrane again 2 x with 20 ml 6x SSC/0.1% SDS at 50°C. Check radioactivity of membrane with Geiger.
Prehybridizaton solution:
6x SSC
5x Denhardt's
20 mM NaH2PO4
500 ug/ml denatured DNASSS (sonicated salmon sperm DNA), boil for 5 min)
Hybridization solution:
6x SSC
20 mM NaH2PO4
0.4 % SDS
300 ug/ml denatured DNASSS (boil for 5 min)
