I

MicroRNA cloning for 454 sequencing

Step A. Preparation of ³²P labeled RNA oligo markers (18 nt and 24 nt) (essentially as in Lau et al, Science 2001).

1. Label, using T4 polynucleotide kinase, about 5 pmole each of RNA oligos DB24 (GGCCAACGUUCUCAACAAUAGUGA) and DB18 (AGCGUCUAGGGAUCCAAA) with ³²P ATP:

10 pMoles RNA oligos (5 pMoles each) 9 ul

gamma ³²P ATP, 250 uCi 6000 Ci/mMole (~40 pMoles) 25 ul

10X kinase buffer (no ATP) 4 ul

NEB T4 Polynucleotide kinase 2 ul

40 ul

37^oC 1 hour

2. Add 20 ug glycogen, 4 ul 3 M NaAcetate, 120 ul 100% ethanol; chill, spin, wash, drain.

3. Dissolve in 20 ul formamide loading buffer, heat to 65^oC for 5 minutes, chill on ice, and load on a 15% acrylamide gel. Electrophorese at 18 volts/cm (150 volts for a 8 cm gel) until the faster dye reaches the bottom of the gel. Elute the hot bands as described in Step B below. Store at -20^oC in 100 ul water. Use within ~2 half-lives.

Step B. Size-selection of small RNA using acrylamide/urea gel (~22 nt).

1. Prepare a 15% acrylamide 8 M urea gel, 4 cm wide by 1.5 mm thick by 8 cm long, using a comb with a ~2 cm wide lane. (The Bio-Rad Protean II minigel system or equivalent is recommended). Accordingly, mix:

2. Add 1X volume formamide loading buffer to 50-100 µg total RNA (in water). Mix in approximately quantity of very high specific activity 5’ ³²P labeled synthetic RNA oligonucleotide. Heat to 65^oC for 5 minutes, chill on ice, and load the gel. Electrophorese at 18 volts/cm (150 volts for a 8 cm gel) until the faster dye reaches the bottom of the gel.

3. Remove the top gel plate and wrap the gel and plate in saran wrap. Visualize the position of the ³²P markers by film or phosporimager. Mark the position of the markers, and cut out a chunk that encompasses the markers.

4. Place the gel slice in a clean siliconized 1.5 ml microcentrifuge tube and homogenize it with a blue plastic homogenizer pestle. The gel slice should be ground up into very small particles. Add 400 µl (at least 4 times the volume of the gel slice) of 20 mM Tris (pH 8.0) 1 mM EDTA 0.3M NH₄Acetate 0.05% SDS, cap the tube tightly, and agitate it for at least 2 hours at room temperature (or overnight).

5. Spin the gel slice homogenate through a filter suitable for trapping the acrylamide fragments (for example, nanosep 300, Pall corp.).

6. Add 1 µl of 20 µg/ml glycogen to the eluate, followed by 3 volumes of 100% ethanol. Cool to –20^oC for at least 10 minutes, and then centrifuge in a refrigerated microcentrifuge at 4^oC for 10 minutes, decant the supernatant. Thoroughly wash the pellet with 70% ethanol, allow the pellet to (almost) dry and dissolve in 200 µl 20 mM Tris (pH 8.0) 1 mM EDTA 0.3M NH₄Acetate, and add 600 µl 100% ethanol and reprecipitate at –20^oC. [Two precipitations are used here to be sure that all the SDS is removed for the subsequent enzymatic steps.] Dissolve in water or 10mM Tris 0.1 mM EDTA pH 7.5. Store at -80^oC.

Step B-1. Alternative size-fractionation of total RNA using Nanosep columns.

1. Dissolve (10 µg) total RNA in 50 µl 99% formamide; 20 mM Tris 7.5; 1 mM EDTA. Add the ³²P marker oligos now for tracing yields and for monitoring the ligation.

2. Heat the sample to 68^oC for 5 minutes, then add 350 µl of 68^oC 6M Urea 1X TBE. Immediately spin sample through a Nanosep 10 column (12,000 rpm at RT).

3. Add 40 µl 3M NaAcetate, plus 20 µg of glycogen, and 1.2 ml 100% ethanol; precipitate at -20^oC for 30 minutes.

4. Spin, wash 2X with 70% ethanol; dissolve in 100 µl 20 mM Tris 7.5; 300 mM NaAcetate, precipitate again with 300 µl ethanol. -20^oC 30 minutes.

5. Spin, wash 2X with 70% ethanol; dissolve in 13 µl water. Store at -80^oC.

Step C. T4 RNA ligase ligation of 3` linker (essentially as in Lau et al, Science 2001).

1. Set up the following reaction:

Size-selected RNA in water (STEP B) 15.0 µl

10X T4 RNA ligase buffer 2.0 µl

100 µM modban linker 1.0 µl

T4 RNA ligase (10U) NEB 2.0 µl

20.0 µl

Size-selected RNA in water (STEP A) 5µl

2X mix 5µl

Total reaction 10µl

# of samples	1	2	3	4	5	6	7	8	9	10	11	12
water	2.4	4.8	7.2	9.6	12.0	14.4	16.8	19.2	21.6	24.0	26.4	28.8
10X RNA lig buffer	1.2	2.4	3.6	4.8	6.0	7.2	8.4	9.6	10.8	12.0	13.2	14.4
100 µM modban	0.6	1.2	1.8	2.4	3.0	3.6	4.2	4.8	5.4	6.0	6.6	7.2
A B RNAse inhibitor	0.6	1.2	1.8	2.4	3.0	3.6	4.2	4.8	5.4	6.0	6.6	7.2
NEB T4 RNAligase (10U)	1.2	2.4	3.6	4.8	6.0	7.2	8.4	9.6	10.8	12.0	13.2	14.4
TOTAL	6.0	12.0	18.0	24.0	30.0	36.0	42.0	48.0	54.0	60.0	66.0	72.0

Incubate at 20^oC for 4 hours.

2. Add 100 µl TE 0.3 mM NaAcetate; Phenol extract. Precipitate with ethanol (add 20 µg glycogen). (-20^oC for at least one hour)

3. Spin, wash with 70% ethanol, dissolve in 20 µl loading buffer for denaturing acrylamide gel (Step C).

-----------------------------------------------------------------------------------------------------------

[The use of the adenylylated oligo “modban” (available from IDT DNA Technologies, idtdna.com) precludes the need to include ATP in the ligation].

Modban: 5’- A5’ppCTGTAGGCACCATCAAT/ddC/-3’

10X T4 RNA ligase buffer: 500 mM Tris-HCl pH 7.5, 100 mM MgCl₂, 100 mM DTT, 600µg/ml BSA

-----------------------------------------------------------------------------------------------------------

Step D. Size-selection of ligation product on denaturing acrylamide gel (~36-42 nt).

Perform as described in Step A, but cut out the ~36-42 nt size range ligation product (DB18 and DB24 + 18 nt modban), visualized using the ³²P markers. The efficiency of the ligation can be monitored by running a small amount of unligated material from Step B. Elute the ligated material, and ethanol precipitate twice as described in Step B. Dissolve the RNA in about 15 µl water and store at -80^oC, or use immediately in step D.

Step E Alternate (also substitutes for steps F and G). Reverse transcription by “smart” protocol. (Essentially as in Lee and Ambros, Science 2001).

-------------------------------------------------------------------------------------------------------------------

Overview.

This method is essentially the one used in Lee and Ambros (2001). Excellent methods have been described by others, and some of these methods differ from this one in important ways. For example, the method developed by the Bartel lab (Lau et al 2001) selectively clones cDNAs corresponding to RNAs with a 5’ terminal monophosphate, and hence is very efficient at cloning microRNA and primary siRNA sequences. The method described below does not utilize RNA ligase to attach the linker to the 5’ end of the RNA, and hence cDNAs can be recovered from microRNAs, but also from RNAs with 5’ ends without a monophosphate (such as unphosphorlyated di- or tri-phosphorylated, or capped RNAs). This has proved useful for cloning secondary siRNAs and certain other endogenous classes of RNAs in C. elegans (Ambros et al, 2003).

For strictly cloning microRNAs, the Bartel method (Lau et al, 2001) may be preferable because it is efficient in the sense that one tends to get fewer “garbage” sequences from degraded RNAs (which will generally be 5’ non-phosphorylated). The method below is advantageous when one is not sure what the 5’ end structure may be for the small RNAs one wishes to identify.

-------------------------------------------------------------------------------------------------------------------

1. Set up the following annealing:

6.3 µl RNA ligation product (in water).

4.2 µl of oligonucleotide mixture:

5 µM Smartban: 5’-ATCGTAGGCACCTGAAAGGG-3’

5 µM BanOne: 5’-ATTGATGGTGCCTACAG-3’

---------

10.5 µl total. Incubate at 72°C for 2 min; spin at 20^oC for 1 min; cool on ice 2 min.

2. Add the following (to make 18.9 µl total):

8.4 µl “RT Mix” Stock of smart RT Mix: 30 µl 5X first strand buffer

15 µl 20 mM DTT

15 µl dNTPs (10mM each)

3. Split the sample into two tubes, 9 µl in each tube:

+ RT : add 1 µl (200U) RNase H^- RT (Invitrogen Superscript II®).

- RT : add 1 µl water.

4. Incubate at 42^oC for 1 hour.

_______________________________________________________________________

NOTE: It is important to use RNAseH defective Reverse Transcriptase, as this permits the terminal transferase activity of RT to add nucleotides at the 3’ end of the cDNA; apparently homopolymeric tri-C (“CCC”) is added frequently enough so that the “GGG” of Smartban primer anneals, followed by copying of Smartban by RT. The resulting cDNA contains BanOne sequence at one end, and the complement of Smartban at the other end, with the small RNA sequence between. This material is ready for PCR amplification (Step H).

_______________________________________________________________________

Step E. Second Round of T4 RNA ligase ligation of linkers. (Essentially as in Lau et al, Science 2001).

1. Set up the following reaction:

Size-selected RNA in water 3.0 µl

T4 RNA ligase Mix 9.0 µl

12.0 µl

2X Mix:

# of samples	1	2	3	4	5	6	7	8	9	10	11	12
water	0.0	0.0	0.0	0.0	0.0	0.0	0.0	0.0	0.0	0.0	0.0	0.0
10X T4 RNA ligase buffer	1.2	2.4	3.6	4.8	6.0	7.2	8.4	9.6	10.8	12.0	13.2	14.4
60 uM ATP	1.2	2.4	3.6	4.8	6.0	7.2	8.4	9.6	10.8	12.0	13.2	14.4
100 µM NL linker	4.8	9.6	14.4	19.2	24.0	28.8	33.6	38.4	43.2	48.0	52.8	57.6
A B RNAse inhibitor	0.6	1.2	1.8	2.4	3.0	3.6	4.2	4.8	5.4	6.0	6.6	7.2
T4 RNA ligase (10U) NEB	1.2	2.4	3.6	4.8	6.0	7.2	8.4	9.6	10.8	12.0	13.2	14.4
TOTAL	9	18	27	36	45	54	63	72	81	90	99	108
sample	3.0	6	9	12	15	18	21	24	27	30	33	36
total total	12	24	36	48	60	72	84	96	108	120	132	144

Incubate at 20^oC for 10 hours.

2. Add 300 µl TE 0.3 mM NaAcetate; Phenol extract. Precipitate with ethanol (add 20 µg glycogen). (-20^oC 30 minutes)

3. Spin, wash with 70% ethanol, dissolve in 20 µl loading buffer for denaturing acrylamide gel.

-------------------------------------------------------------------------------------------------------------------------

NL linker For 454:

5’ATCGTrArGrGrCrArCrCrUrGrArArA 3’.

(BanTwo sequence)

------------------------------------------------------------------------------------------------------------------------

Step F. Size-selection of ligation product on denaturing acrylamide gel (~75 nt).

Perform as described in Step A, but cut out the ~75 nt ligation product (22 nt + 18 nt modban + 35 nt NLRG2bar_01), visualized using the ³²P marker. Elute the ligated material, and ethanol precipitate twice as described in Step A. Dissolve the RNA in about 7 µl water and use immediately in Step G.

Step G. Reverse transcriptase. (Essentially as in Lau et al, Science 2001).

Using siliconized tubes, set up a reverse transcription reaction:

5 µl of ligated RNAs

1 µl 100 µM RT ban or banOne

10 µl dH2O

16 µl Heat to 80^oC for 2 min; Spin down to cool

6 µl 5X First Strand Buffer (Invitrogen)

7 µl 10X dNTP’s (10 mM each)

3 µl 100mM DTT

32 µl

Take out 3 µl for a (-)RT control.

29 µl

1 µl SuperScript III RT (200U/µl) final (6000 U/30µl)

30 µl

Incubate at 48^oC for 1 hour. This material is ready for PCR (Step H).

Step H. PCR

This method is to prepare material for 454 sequencing. Therefore, the PCR primers correspond to smartban and modban, respectively, but with 454 adapter sequences appended. Moreover, for efficiency, the sequencing can multiplexed: Libraries from different samples can be prepared each with a distinctive “barcoded” pair of fusion primers for the PCR step, and the libraries (10 or more, for example) can be mixed together for sequencing in a single 454 run. Examples of barcoded primer pairs are as follows (barcode in bold):

-----------------------------------------------------------------------------------------------------------------------

FPA_bar_01: 5’-GCCTCCCTCGCGCCATCAGCATGATCGTAGGCACCTGAAA

454 adapter BanTwo

FPB_bar_01: 5’-GCCTTGCCAGCCCGCTCAGCATGATTGATGGTGCCTACAG

454 adapter BanOne

See below for additional barcoded oligos of this design.

-----------------------------------------------------------------------------------------------------------------------

Template (dilution of about 5% of cDNA)	50.0
Taq mix	50.0
Total	100.0

Taq mix:


water	25.0
dNTPs (2mM)	10.0
10 X buffer (15 mM MgCl)	10.0
Primer A (50µM)	2.0
Primer B (50 µM)	2.0
Taq	1.0
Total	50.0