IRAP, REMAP and iPBS for retrotransposon-based genotyping and fingerprinting


Kalendar R, Schulman AH 2006. IRAP and REMAP for retrotransposon-based genotyping and fingerprinting. Nature Protocols, 1(5): 2478-2484. (pdf)

Kalendar R, Antonius K, Smykal P, Schulman AH 2010. iPBS: A universal method for DNA fingerprinting and retrotransposon isolation. Theoretical and Applied Genetics, 121(8): 1419-1430. (pdf)

Kalendar R, Schulman AH 2014. Transposon based tagging: IRAP, REMAP, and iPBS. Molecular Plant Taxonomy: Methods and Protocols, Methods in Molecular Biology, Besse Pascale (Ed.), Humana Press, 1115: 233-255; ISBN 978-1-62703-766-2, DOI: 10.1007/978-1-62703-767-9_12 (pdf)

© 2006-2016 All Rights Reserved, Ruslan Kalendar, University of Helsinki.


Abstract

Retrotransposons can be used for markers because their integration creates new joints between genomic DNA and their conserved ends. To detect polymorphisms for retrotransposon insertion, marker systems generally rely on PCR amplification between these ends and some component of flanking genomic DNA. We have developed two methods, REMAP (REtrotransposon-Microsatellite Amplified Polymorphism) and IRAP (Inter-Retrotransposon Amplified Polymorphism), which require neither restriction enzyme digestion nor ligation to generate the marker bands. The IRAP products are generated from two nearby retrotransposons using outward-facing primers. In REMAP, amplification between retrotransposons proximal to simple sequence repeats (microsatellites) produces the marker bands. Here, we describe protocols for the IRAP and REMAP techniques, including methods for PCR amplification with a single primer or with two primers and agarose gel electrophoresis of the product using optimal electrophoresis buffers and conditions. This protocol can be completed in one to two days.

INTRODUCTION

Long Terminal Repeat (LTR) retrotransposons, or Type I transposable elements, replicate by a process of reverse transcription resembling that of the lentiviruses (such as the HIV) 1. The retrotransposons themselves encode the proteins needed for their replication and integration back into the genome 2. Their “copy and paste” life cycle means that they are excised in order to insert a copy elsewhere in the genome. Hence, genomes diversify by the insertion of new copies, but old copies persist. Their abundance in the genome is generally highly correlated with genome size. Large plant genomes contain hundreds of thousands of these elements, together forming the vast majority of the total DNA 3. Human and other mammalian genomes also contain an abundance of retrotransposons. The majority of these, however, are not LTR retrotransposons but LINEs and SINEs, which replicate by a somewhat different copy-and-paste mechanism 4, 5. The L1 family of LINE elements and the Alu family of SINE elements comprise together roughly 30% of human genomic DNA and nearly two million copies 6. The features of integration activity, persistence, dispersion, conserved structure and sequence motifs and high copy number together suggest that retrotransposons are well suited genomic features on which to build molecular marker systems.

 Marker systems based on transposable elements, in contrast to other methods, detect large changes in the genome. By comparison, RFLP (Restriction Fragment Length Polymorphism), SNP (Single Nucleotide Polymorphism) and, to some extent, AFLP (Amplified Fragment Length Polymorphism) detect single nucleotide changes that are bi-directional (have a fairly high reversion frequency), whereas SSR (Simple Sequence Repeat) or microsatellite polymorphisms track the gain or loss of generally less than 20 nucleotides. Microsatellite alleles differ by the number of SSRs they contain and, like single nucleotide changes, also suffer from homoplasy because the number of SSRs can increase or decrease reversibly, making it impossible to distinguish ancestral and derived states.

 Retrotransposon-based systems (Figure 1) detect the insertion of elements hundreds to thousands of nucleotides long. The LTRs that bound a complete retrotransposon contain ends that are highly conserved in a given family of elements. Newly inserted retrotransposons, therefore, form a joint between the conserved LTR ends and flanking, anonymous genomic DNA. Most retrotransposon-based marker systems use PCR to amplify a segment of genomic DNA at this joint. Generally, one primer is designed to match a segment of the LTR conserved with a given family of elements but different in other families. The primer is oriented towards the LTR end. The second primer is designed to match some other feature of the genome. The first retrotransposon method described was S-SAP or SSAP (Sequence-Specific Amplified Polymorphism, Figure 1c), where one primer matched the end of the BARE-1 retrotransposon of barley and the other matched an AFLP-like restriction site adapter 7. The S-SAP method has since been applied using other retrotransposons in barley 8 as well as in other plants including wheat and its relatives 9, 10, oat 11, apple 12, artichoke 13, lettuce 14, pea and other legumes 15-17, pepper and tomato 18 and sweet potato 19.

 The IRAP (Inter-Retrotransposon Amplification Polymorphism, Figure 1a) and REMAP (Retrotransposon-Microsatellite Amplification Polymorphism, Figure 1b) methods represent a departure from S-SAP, because no restriction enzyme digestion or ligation step is needed and because the products can be resolved by conventional agarose gel electrophoresis without resort to a sequencing apparatus. The IRAP method detects retrotransposon insertional polymorphisms by amplifying the portion of DNA between two retroelements. It uses one or two primers pointing outwards from an LTR, and therefore amplifies the tract of DNA between two nearby retrotransposons. IRAP can be carried out with a single primer matching either the 5’ or 3’ end of the LTR but oriented away from the LTR itself, or with two primers. The two primers may be from the same retrotransposon element family or may be from different families. The PCR products, and therefore the fingerprint patterns, result from amplification of hundreds to thousands of target sites in the genome. The complexity of the pattern obtained will be influenced by the retrotransposon copy number, which mirrors genome size, as well as by their insertion pattern and by the size of the retrotransposon families chosen for analysis. Furthermore, thousands of products can neither be simultaneously amplified to detectable levels nor resolved on a gel system. Hence, the pattern obtained represents the result of competition between the targets and products in the reaction. As a result, the products obtained with two primers do not represent the simple sum of the products obtained with the primers individually.

 If retrotransposons were fully dispersed within the genome, IRAP would either produce products too large to give good resolution on gels or target amplification sites too far apart to produce products with the available thermostable polymerases. However, IRAP has succeeded for all genomes tried to date (see below). This is because retrotransposons generally tend to cluster together in “repeat seas” surrounding “genome islands”, and may even nest within each other. For example, the BARE-1 retrotransposon of barley, an abundant copia element, is present as about 13 000 full-length copies of about 8.9 kb and 90 000 solo LTRs of 1.8 kb in the cultivar Bomi 20, Given a genome of roughly 5 x 109 bp, these elements comprise 5.6% of the genome but would occur only about once every 46 kb if they were fully interspersed. Nevertheless, IRAP with BARE-1 primers displays a range of products from 100 bp upwards of 10 kb (e.g., Figures 2 and 3, below).

The REMAP method is similar to IRAP, but one of the two primers matches an SSR motif with one or more non-SSR anchor nucleotides present at the 3’ end of the primer. Microsatellites of the form (NN)n, (NNN)n or (NNNN)n are found throughout plant and animal genomes. In cereals, they furthermore appear to be associated with retrotransposons 21. Due to phenomena including polymerase slippage, microsatellites have high mutation rates and therefore may show much variation at individual loci within a species. Differences in the number of SSR units in a microsatellite are generally detected using primers designed to unique sequences flanking microsatellites. Alternatively, the stretches of the genome present between two microsatellites may be amplified by ISSR 22, in a way akin to IRAP. In REMAP, anchor nucleotides are used at the 3’ end of the SSR primer both to avoid slippage of the primer within the SSR, which would produce a “stutter” pattern in the fingerprint, and to avoid detection of variation in repeat numbers within the SSR. REMAP uses primer types that are shared by IRAP and ISSR. Although it would appear that the SSR primers in REMAP should also yield ISSR products and the LTR primers also IRAP products, in practice this is rarely the case. This is probably due to a combination of factors including both genome structure and competition within the PCR reactions.

 Still another retrotransposon-based marker method has been developed in addition to S-SAP, IRAP and REMAP. However, this method, RBIP (Retrotransposon-Based Insertional Polymorphism, Figure 1d) 23, 24, is conceptually more similar to the microsatellite method where SSR domain sizes are scored. Unlike the other methods displaying retrotransposon insertion sites, which fingerprint multiple loci simultaneously and anonymously, RBIP types a single locus. RBIP requires knowledge of unique sequences flanking a retrotransposon insertion so that a particular locus can be scored. Hence, development of a set of RBIP markers requires either extensive sequencing of insertion flanks or a fairly large genomic database for primer design. Therefore, it has not been extensively applied beyond Pisum, where it was initially described. Its advantage, however, is codominant scoring: it can detect both the full and empty allelic states for a retrotransposon insertion site. Co-dominant scoring is very powerful for pedigree reconstruction; tracking of SINE insertions has served to link the cetacean lineage to that of ungulates 25.

 The REMAP and IRAP methods require comparatively little sequence information before implementing them in a new plant species. The primary requirement is the sequence of an LTR end, harvested either from a database or produced by cloning and sequencing the genomic DNA that flanks conserved segments of retrotransposons 26. For REMAP, anchored SSR primers can be designed without reference to sequence data and then tested for usefulness. Following their initial description 27, IRAP and REMAP have been applied in species ranging from barley, wheat and their relatives 8, 28, 29 to oat 30, apple 31, banana 32, citrus 33, grapevine 34, pea 35 and sawgrass (Spartina) 36. It has also been applied to genotyping fungi 37, 38. In addition to these organisms, we have developed and applied IRAP and REMAP in canola and turnip (Brassica rapa and B. napus) as well as in sunflower and Brachypodium (unpublished data). The wide applicability of these methods shows that the retrotransposons are organised in other genomes in a manner sufficiently similar to that of the cereals 39, where the methods were originally developed.

The retrotransposon methods described above provide consistent data 40. Although S-SAP is somewhat more general than IRAP or REMAP, requiring only a restriction site near the outer flank of a retroelement, its requirement for two additional enzymatic steps introduces the possibility of artifacts from DNA impurities, methylation, and incomplete digestion or ligation. Furthermore, S-SAP generally requires selective nucleotides on the 3’ ends of the retrotransposon primers in order to reduce the number of amplification products and increase their yield and resolvability. As for IRAP and REMAP, the resulting subsets of amplifiable products are not additive 8. Although RBIP confers the power of codominance, developing flanking primers to nested retrotransposon insertions, which can constitute many of the insertions in cereals, is difficult and a method is therefore required for efficient mining of unique flanks. The strength of all these methods is that the degree of phylogenetic resolution obtained depends on the history of activity of the particular retrotransposon family being used. Hence, it is possible to analyse both ancient evolutionary events such as speciation as well as the relationships and similarities of recently derived breeding lines. The IRAP and REMAP can be generalised, furthermore, to other transposable element systems such as to MITEs, and to other organisms. For example, the SINE element Alu of humans has been used in a method called Alu-PCR in a way similar to IRAP and REMAP 41.

 MATERIALS

 REAGENTS

EQUIPMENT

REAGENT SETUP

PCR reaction buffers: several PCR reaction buffers are suitable for PCR: ThermoPol® Buffer, 1X: 20 mM Tris-HCl (pH 8.8, 25°C), 2 mM MgSO4, 10 mM KCl, 10 mM (NH4)2SO4; Buffer 2, 1X: 10 mM Tris-HCl (pH 8.8, 25°C), 2 mM MgCl2, 50 mM KCl, 0.1% Triton X-100; Buffer 3, 1X: 50 mM Tris-HCl (pH 9.0, 25°C), 2 mM MgCl2, 15 mM (NH4)2SO4, 0.1% Triton X-100. ▲Critical The PCR reaction and its efficiency depend on which buffer and enzyme combination is used. Most enzymes are supplied with their own recommended buffer; these buffers are often suitable for other thermostablepolymerases as well. The concentration of MgCl2 (MgSO4) can be varied from 1.5 to 3 mM without influencing the fingerprinting results. A higher MgCl2 concentration can increase the PCR efficiency and allow reduction in the number of PCR cycles from 32 to 30 and also help in PCR reactions containing somewhat impure DNA. Additional components such as (listed at their final concentration in the reaction buffer) 5% acetamide (Sigma A6082), 0.5 M betaine (N,N,N-trimethylglycine, Sigma B-2629), 3% DMSO (Sigma D9170), 5% glycerol (Sigma G8778), 5% PEG 8000 and 5-20 mM TMA (Tetramethylammonium chloride, Sigma T3411) can increase the PCR efficiency for multiple templates and PCR products 42. 

 
EQUIPMENT SETUP

 Procedure

 Primer Design

1         Design a PCR primer to match an LTR sequence near to either its 5’ or 3’ end, and orient the primer so that the amplification direction is towards the nearest end of the LTR. Generally it is best to base the design on a sequence alignment for representative LTRs from a particular family of elements and to place the primer within the most conserved region for that family. For long LTRs, it is often useful to test primers at several locations within the LTR and in both orientations, particularly if there is evidence for nested insertions in the genome. Primers can be placed directly at the end of the LTR facing outward, provided that they do not form dimers or loops. For primers placed at the edge of the LTR, one or more additional selective bases can be added at 3’end in order to reduce the number of amplification targets. This can be tried in a second round of primer design, if the initial primer yields amplification products containing too many weak individual species for analysis by gel electrophoresis. If the LTRs are short (<300 bp), the primers may also be designed to match internal regions, but this will concomitantly increase the size of the amplified products. Microsatellite primers for REMAP or ISSR should be designed according to two principles: first, primer length should be between 19 - 22 bases; second, the last base at 3’-end of the primer is designed as selective base, which is absent in repeat unit itself.  Examples of LTR conservation and consequent primer design for LTRs and microsatellites are shown in Box 1 and 2.

▲CRITICAL STEP We have designed LTR primers using the “FastPCR” software (R. Kalendar). Database searches can sometimes be used to find un-annotated, native LTR sequences matching characterised retrotransposons from other species. However, care should be taken in defining the ends of the LTRs. Generally, mapping of the reverse transcriptase primer binding sites PBS and PPT is needed in order to define the LTR ends with confidence.

 

Box 1: Example of IRAP and REMAP primer design: conserved 3’ end of Sukkula LARD LTRs and matching primer
TCCATTCTTGCGACACGACGAGATGCGCTTCTATCCCTGACGAGGCCCTCGTACCAAATTGAGGATAGGGTCGCATCTTGGGCGTGACA
TCCATTCTTGCGACAGGACGAGATGCGCTTCTATCCCTGACGAGGCCTTCGTGCCAAATTAAGGATAGGGTCGCATCTTGGGCGTGACA
TCCATTCTTGCGACACGACGAGATGCGCTTCTATCCCTGACGAGGCCTTCGTGCCAAATTGAGGATAGGGTCGCATCTTGGGCGTGACA
TCCATTCTTGCGACACGACGAGATGCGCTTCTATCCCTGACGAGGCCTTCGTGCCAAATTGAGGATAGGGTCGCATCTTGGGCGTGACA
TCCATTCTTGCGACACGACGAGATGCACTTCTATCCCTGTCGAGGCCCTCGTGCCAAAATAAGGATAGGGTCGCATCTTGGGCGTGACA
TCCATTCTTGCGACACGACGAGATGCGCTTCTACCCCTGTCGAGGCCCTCGTGCCAAAATAAGGATAGGGTCGCATCTTGGGCGTGACA
TCCATTCTTGCAACATGACGAGATGCGCTTCTATCCCTGTCGAGGCCCTCGTGCCAAAATAAGGATAGGGTCGCATCTTGGGCGTGACA
TCCATTCTTGCGACACGACGAGATGCGCTTCTATCCCTGACGAGGCCTTCGTGCCAAAGTGAGGATAGGGTCGCATCTTGGGCGTGACA
TCCATTCTTGCGACACGACGAGATGCGCTTCTATCCCTGACGAGGCCCTCGTGCCAGATTGAGGATAGGGCCGCATCTTGGGCGTGACA
TACTTGCTTGTGAAACGCTTAGATGCGCTTCTTTCCTATTCGGGGGCCTCGACCCCCAAATCGGAAAGGACCGCATCTTGGTCATTACA
* * * **** * * *  ****** ***** **   ** ** * *** ** *   *** *** ********** * * ***
TCCATTCTTGCGACACGACGAGATGCGCTTCTATCCCTGACGAGGCCCTCGTGCCAAATTGAGGATAGGGTCGCATCTTGGGCGTGACA
                                                              5’-tagggtcgcatcttgggcgtgaca

Box 2:  Microsatellite primer examples
Two-base-repeat microsatellites:
(CT)n microsatellites: 5’(CT)11G, 5’(CT)11T, or 5’(CT)11A
(CA)n microsatellites: 5’(CA)11G, 5’(CA)11T, or 5’(CA)11A
(TG)n microsatellites: 5’(TG)11G, 5’(TG)11C, or 5’(TG)11A
(AG)n microsatellites: 5’(AG)11G, 5’(AG)11C, or 5’(AG)11T
(AC)n microsatellites: 5’(AC)11G, 5’(AC)11C, or 5’(AC)11T

Three-base-repeat microsatellites:
(CTC)n microsatellite: 5’(CTC)7G, 5’(CTC)7T, or 5’(CTC)7A
(GTG)n microsatellite: 5’(GTG)7C, 5’(GTG)7T, or 5’(GTG)7A
(CAC)n microsatellite: 5’(CAC)7G, 5’(CAC)7T, or 5’(CAC)7A
(ACC)n microsatellite: 5’(ACC)7G, 5’(ACC)7T, or 5’(ACC)7C
(TCG)n microsatellite:  5’(TCG)7G, 5’(TCG)7C, or 5’(TCG)7A

                                                                                                                                               

Polymerase chain reaction (PCR) ● timing ~ 2-2.5 h

2         Perform PCR in a 25 µl reaction mixture containing 25 ng DNA, 1x ThermoPol® buffer (20 mM Tris-HCl (pH 8.8, 25°C), 2 mM MgSO4, 10 mM KCl, 10 mM (NH4)2SO4), 0.5 µM primer(s), 200 µM dNTP, 1U Taq polymerase, and recommended to add 0.005 unit of Pfu DNA Polymerase). The standard PCR reaction (120 min) should consist of: a 3 min denaturation step at 95°C; 28-31 cycles of 15s at 95°C, 30s at 60°C and 90s at 72°C; a 5 min a final extension at 72°C.

▲Critical STEP The amount of template DNA plays an important role in the quality of the resulting fingerprint. Most commonly, 1ng DNA per 1µl of reaction volume is ideal. Much higher DNA concentrations will produce smears between the bands, which is a sign of over-amplification.

▲Critical STEP DNA and primers should be stored in a 1xTE solution, 10 mM Tris-HCl, 1 mM EDTA, pH 8.0.

▲Critical STEP The final primer concentration(s) in the reaction can vary from 200 to 400 nM. Although higher primer concentrations increase PCR efficiency and the rapidity of DNA amplification, they also produce over-amplified products, such as shown in Figure 2b.

▲Critical STEP DNA quality is very important for obtaining high-quality results. Standard DNA extraction methods are sufficient to yield DNA of high quality from most of samples. DNA should be free of polysaccharides, pigments, and secondary metabolites. Some plant materials contain polysaccharides, pigments, oils or polyphenols, which can reduce the efficiency of PCR. Furthermore, contaminated DNAs will decline in PCR performance during prolonged (a month or more) periods of storage, due to chemical modification. Such DNAs (for example, from Brassica spp.) should be extracted with methods involving sodium hydroxide, followed by two ethanol DNA precipitations. High-quality DNA can be stored at 4°C for many years without showing any PCR inhibition or decrease in amplification efficiency for the longer bands.

▲Critical STEP PCR thermal conditions can be varied without large effects on the resulting band pattern. The denaturation step in PCR can be carried out at 94°C for 30s or 95°C for 20s or 98°C for 5s. The length of the annealing step can vary from 10 to 30 second at 60°C. The annealing temperature varies with the melting temperature of the primer; it should be between 55 and 68°C (60°C is optimal for almost all primers and their combinations in IRAP and REMAP).

●PAUSE POINT PCR reactions can be stored at 4°C overnight with loading buffer or without.

 

Casting the agarose gel ● TIMING ~2-3 h

3         Prepare 200 ml of 1.5% (w/v) agarose containing 1xTHE buffer in a 500 ml bottle. This volume is required for one gel with the dimensions 0.4 cm x 20 cm x 20 cm. Dissolve and melt the agarose in a microwave oven. The bottle should be closed, but the plastic cap must not be tightened! The agarose gel must be completely melted in the microwave and then allowed to slowly cool until its temperature drops to about 60-65°C. At that point, if desired, add the ethidium bromide solution at a rate of 100 ul per 100 ml, to bring the final concentration to 0.5 ug per ml (alternatively the gel can be stained at the end of the run).

▲CAUTION Take care not to boil over the agarose. Add ethidium bromide only after removing the agarose from the microwave oven to minimise risks from boil-over.

▲Critical STEP The agarose gel must melt and dissolve properly. Small undissolved inclusions will severely hamper the quality of the results. Do not allow the gel to cool unevenly before casting, for example by leaving it stand on the benchtop or in cool water. The best way to cool the agarose is by shaking it at 37°C for 15 minutes.

4)  Pour the agarose into the gel tray (20 x 20 cm). Allow the agarose to solidify at room temperature for one hour minimum.

▲Critical STEP For optimal resolution, cast horizontal gels 3 – 4 mm thick. The volume of gel solution needed can be estimated by measuring the surface area of the casting chamber and then multiplying by gel thickness.

 5)  Fill the chamber with 1xTHE running buffer until the buffer reaches about 2-3 mm over the surface of the gel.

 
Sample preparation and loading ● timing ~ 15 min

6         Add an equal volume of 2x loading buffer to the completed PCR reactions in tube or plate and mix well. Collect the mixture by a short centrifugation (by turning a benchtop microcentrifuge on and immediately off again). Load the gels with a sample volume of 10 µl.

▲Critical STEP The DNA concentration plays an important role in gel resolution. Overloaded lanes will result in poor resolution.

 
Gel electrophoresis ● timing ~3-5 h

7         Select running conditions appropriate to the configuration of your electrophoresis box. For a standard 20 x 20 cm gel, carry out electrophoresis at a constant 80-100 V for 3-8 h (a total of 600 volt-hours). Electrophoresis may cause the gels to after several hours; their temperature should not be allowed to exceed 50°C, above which electrophoretic resolution will be impaired. Still better results are obtained with a slower run. We routinely use 100 V for 6 h (600 volt-hours).As the end of the run approaches, it is helpful to check the run with a UV-transluminator.

▲Critical STEP For samples with many or large (> 1000 bp) bands, perform the gel electrophoresis at a constant voltage of 50 V overnight (14 h) as shown in Figure 3.

 

DNA visualization ● timing ~15 min

8)  DNA can be visualized directly by casting ethidium bromide into gel as described above, or by incubating in an ethidium bromide solution of equivalent strength following electrophoresis.

Scan the gels on an Typhoon FLA 9500 imaging system (GE Healthcare Life Sciences) GmbH., Germany) or equivalent scanner with a resolution of 50-100µm.

TIMING
Primer design (step 1), ~1-2 h
Polymerase chain reaction (PCR; step 2), ~ 2-2.5 h
Casting the agarose gel (steps 3-5), ~2-3 h
Sample preparation and loading (step 6), ~ 15 min
Gel electrophoresis (step 7)  ~3-7 h
DNA visualization (step 8) ~15 min

 ? TROUBLESHOOTING

Occasionally, not all primers (derived from either retrotransposons or microsatellites) will work in the PCR. The genome may contain too few retrotransposon or microsatellite target sites, or they may be too dispersed for the generation of PCR products. Alternatively sequence divergence in old retrotransposons or polymorphisms between heterologous primers and native elements may lead to poor amplification.  Some primers generate smears under all PCR conditions. Many sources can contribute to this problem, ranging from primer structure to variability in the target site and competition from other target sites. Generally, it is more efficient to design another primer than to try to identify the source of the problem. Furthermore, primers which produce a single, very strong band are not suitable for fingerprinting.

 The DNA quality is very important, as it is for most PCR-based methods. DNA purification with a spin-column containing a silica-gel membrane (such as Qiagen) is not a guarantee of high DNA quality for all plant samples or tissues. One sign of DNA contamination is that, after some period of time (a month or more) in storage, only short bands can be amplified. Careful casting of gels is critical to success. Small, undissolved agarose inclusions in the gels will result in bands with spiked smears. Finally, a high-quality gel scanner with good sensitivity and resolution is also very important. Older still-video systems, which may be suitable for checking the success of restriction digests, cloning reactions or simple PCR reactions, are not suitable for analysis of complex banding patterns.

 

ANTICIPATED RESULTS

Development of a new marker system for an organism in which retrotransposons have not been previously described generally takes one to six months. The availability of heterologous and conserved primers as well as experience in primer design, sequence analysis, and testing speeds up the development cycle. Routine analysis of samples with optimised primers and reactions may be carried out thereafter. Retrotransposons have several advantages as molecular markers. Their abundance and dispersion can yield many marker bands, the pattern possessing a high degree of polymorphism due to transpositional activity. The LTR termini are highly conserved even between families, yet longer primers can be tailored to specific families. Unlike DNA transposons, the new copies are inserted but not removed. Even intra-element recombination resulting in the conversion of a full-length element to a solo LTR does not affect its performance in IRAP or REMAP. Retrotransposon families may vary in their insertional activity, allowing the matching of the family used for marker generation to the phylogenetic depth required. The primers for different retrotransposons and SSRs can be combined in many ways to increase the number of polymorphic bands to be scored. Furthermore, the length and conservation of primers to the LTRs facilitate cloning of interesting marker bands and the development of new retrotransposons for markers. The IRAP and REMAP fingerprinting patterns can be used in a variety of applications, including measurement of genetic diversity and population structure 36, 43, determination of essential derivation, marker-assisted selection, and recombinational mapping 7, 8, 29, 34, 44. In addition, the method can be used to fingerprint large genomic clones (e.g., BACs) for the purpose of assembly. The method can be extended, as well, to other prevalent repetitive genomic elements such as MITEs

REFERENCES

1. Feschotte, C., Jiang, N. & Wessler, S. Plant transposable elements:  Where genetics meets genomics. Nat. Rev. Genet. 3, 329-341 (2002).

2. Sabot, F. & Schulman, A.H. Parasitism and the retrotransposon life cycle in plants: A hitchhiker's guide to the genome. Heredity, 97, 381-388 (2006).

3. Schulman, A.H. & Kalendar, R. A movable feast: Diverse retrotransposons and their contribution to barley genome dynamics. Cytogenet. Genome Res 110, 598-605 (2005).

4. Hedges, D.J. & Batzer, M.A. From the margins of the genome: mobile elements shape primate evolution. BioEssays 27, 785-794 (2005).

5. Ostertag, E.M. & Kazazian, H.H. Genetics: LINEs in mind. Nature 435, 890-891 (2005).

6. Jurka, J. Evolutionary impact of human Alu repetitive elements. Curr. Opin. Genet. Dev. 14, 603-608 (2004).

7. Waugh, R. et al. Genetic distribution of BARE-1-like retrotransposable elements in the barley genome revealed by sequence-specific amplification polymorphisms (S-SAP). Mol. Gen. Genet. 253, 687-694 (1997).

8. Leigh, F. et al. Comparison of the utility of barley retrotransposon families for genetic analysis by molecular marker techniques. Mol. Genet. Genomics 269, 464-474 (2003).

9. Queen, R.A., Gribbon, B.M., James, C., Jack, P. & Flavell, A.J. Retrotransposon-based molecular markers for linkage and genetic diversity analysis in wheat. Molecular and General Genomics 271, 91-97 (2004).

10. Nagy, E.D., Molnar, I., Schneider, A., Kovacs, G. & Molnar-Lang, M. Characterization of chromosome-specific S-SAP markers and their use in studying genetic diversity in Aegilops species. Genome 49, 289-296 (2006).

11. Yu, G.-X. & Wise, R.P. An anchored AFLP- and retrotransposon-based map of diploid Avena. Genome 43, 736-749 (2000).

12. Venturi, S., Dondini, L., Donini, P. & Sansavini, S. Retrotransposon characterisation and fingerprinting of apple clones by S-SAP markers. Theor. Appl. Genet. 112, 440-444. (2006).

13. Lanteri, S. et al. A first linkage map of globe artichoke (Cynara cardunculus var. scolymus L.) based on AFLP, S-SAP, M-AFLP and microsatellite markers. Theor. Appl. Genet. 112, 1532-1542 (2006).

14. Syed, N.H. et al. A detailed linkage map of lettuce based on SSAP, AFLP and NBS markers. Theor. Appl. Genet. 112, 517-527 (2006).

15. Jing, R. et al. Insertional polymorphism and antiquity of PDR1 retrotransposon insertions in Pisum species. Genetics doi, 10.1534/genetics.1105.045112 (2005).

16. Porceddu, A. et al. Development of S-SAP markers based on an LTR-like sequence from Medicago sativa L. Mol. Genet. Genomics 267, 107-114 (2002).

17. Ellis, T.H.N., Poyser, S.J., Knox, M.R., Vershinin, A.V. & Ambrose, M.J. Ty1-copia class retrotransposon insertion site polymorphism for linkage and diversity analysis in pea. Mol. Gen. Genet. 260, 9-19 (1998).

18. Tam, S.M. et al. Comparative analyses of genetic diversities within tomato and pepper collections detected by retrotransposon-based SSAP, AFLP and SSR. Theor. Appl. Genet. 110, 819-831 (2005).

19. Tahara, M. et al. Isolation of an active element from a high-copy-number family of retrotransposons in the sweetpotato genome. Molecular and General Genomics 272, 116-127 (2004).

20. Vicient, C.M. et al. Retrotransposon BARE-1 and its role in genome evolution in the genus Hordeum. Plant Cell 11, 1769-1784 (1999).

21. Ramsay, L. et al. Intimate association of microsatellite repeats with retrotransposons and other dispersed repetitive elements in barley. Plant J. 17, 415-425 (1999).

22. Zietkiewicz, E., Rafalski, A. & Labuda, D. Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification. Genomics 20, 176-183 (1994).

23. Flavell, A.J., Knox, M.R., Pearce, S.R. & Ellis, T.H.N. Retrotransposon-based insertion polymorphisms (RBIP) for high throughput marker analysis. Plant J. 16, 643-650 (1998).

24. Flavell, A.J. et al. A microarray-based high throughput molecular marker genotyping method: the tagged microarray marker (TAM) approach. Nucl. Acids Res. 31, e115 (2003).

25. Shedlock, A.M. & Okada, N. SINE insertions: powerful tools for molecular systematics. Bioassays 22, 148-160 (2000).

26. Pearce, S.R. et al. Rapid isolation of plant Ty1-copia group retrotransposon LTR sequences for molecular marker studies. Plant J. 19, 711-717 (1999).

27. Kalendar, R., Grob, T., Regina, M., Suoniemi, A. & Schulman, A.H. IRAP and REMAP:  Two new retrotransposon-based DNA fingerprinting techniques. Theor. Appl. Genet. 98, 704-711 (1999).

28. Boyko, E., Kalendar, R., Korzun, V., Gill, B. & Schulman, A.H. Combined mapping of Aegilops tauschii by retrotransposon, microsatellite, and gene markers. Plant Mol. Biol. 48, 767-790 (2002).

29. Manninen, O., Kalendar, R., Robinson, J. & Schulman, A.H. Application of BARE-1 retrotransposon markers to map a major resistance gene for net blotch in barley. Mol. Gen. Genet. 264, 325-334 (2000).

30. Tanhuanpää, P. et al. Generation of SNP markers for short straw in oat (Avena sativa L.). Genome 49, 282-287 (2006).

31. Antonius-Klemola, K., Kalendar, R. & Schulman, A.H. TRIM retrotransposons occur in apple and are polymorphic between varieties but not sports. Theor. Appl. Genet. 112, 999-1008 (2006).

32. Teo, C.H. et al. Genome constitution and classification using retrotransposon-based markers in the orphan crop banana. J. Plant Biol. 48, 96-105 (2005).

33. Breto, M.P., Ruiz, C., Pina, J.A. & Asins, M.J. The diversification of Citrus clementina Hort. ex Tan., a vegetatively propagated crop species. Mol. Phylogenet. Evol. 21, 285-293 (2001).

34. Pereira, H.S., Barao, A., Delgado, M., Morais-Cecilio, L. & Viegas, W. Genomic analysis of Grapevine Retrotransposon 1 (Gret 1) in Vitis vinifera. Theor. Appl. Genet. 111, 871-878 (2005).

35. Smykal, P. Development of an efficient retrotransposon-based fingerprinting method for rapid pea variety identification. Journal of Applied Genetics, 221-230 (2006).

36. Baumel, A., Ainouche, M., Kalendar, R. & Schulman, A.H. Inter-retrotransposon amplified polymorphism (IRAP), and retotransposon-microsatellite amplified polymorphism (REMAP) in populations of the young allopolyploid species Spartina angelica Hubbard (Poaceae). Mol. Biol. Evol. 19, 1218-1227 (2002).

37. Chadha, S. & Gopalakrishna, T. Retrotransposon-microsatellite amplified polymorphism (REMAP) markers for genetic diversity assessment of the rice blast pathogen (Magnaporthe grisea). Genome 48, 943-945 (2005).

38. Díez, J., Béguiristain, T., Le Tacon, F., Casacuberta, J.M. & Tagu, D. Identification of Ty1-copia retrotransposons in three ectomycorrhizal basidiomycetes: evolutionary relationships and use as molecular markers. Curr. Genet. 43, 34-44 (2003).

39. Schulman, A.H., Gupta, P.K. & Varshney, R.K. in Cereal Genomics. (eds. P.K. Gupta & R.K. Varshney) 83-118 (Kluwer Academic Press, Dordrecht, The Netherlands; 2004).

40. Schulman, A.H., Flavell, A.J. & Ellis, T.H.N. The application of LTR retrotransposons as molecular markers in plants. Methods Mol. Biol. 260, 145-173 (2004).

41. Tang, J.Q. et al. Alu-PCR combined with non-Alu primers reveals multiple polymorphic loci. Mamm. Genome 6, 345-349. (1995).

42. Kovarova, M. & Draber, P. New specificity and yield enhancer of polymerase chain reactions. Nucl. Acids Res. 28, E70 (2000).

43. Kalendar, R., Tanskanen, J., Immonen, S., Nevo, E. & Schulman, A.H. Genome evolution of wild barley (Hordeum spontaneum) by BARE-1 retrotransposon dynamics in response to sharp microclimatic divergence. Proc. Natl. Acad. Sci. USA 97, 6603-6607 (2000).

44. Asins, M.J. et al. QTL analysis of citrus tristeza virus-citradia interaction. Theor. Appl. Genet. 108, 603-611 (2004).



Figure 1 Retrotransposon-based marker methods. The figure displays the genomic features and the positions of the priming sites for the major methods described in the text. (a) IRAP. Amplification is carried out between the LTRs of two retrotransposons. Genomic DNA (gDNA) is shown as a solid blue line, primers as arrows above and below the genome segment, the retrotransposon as comprised of LTRs and a core domain (core). Other features may be present in the genome, such as microsatellites (SSRs) or restriction sites (R), but IRAP method does not take them into account. (b) REMAP. Amplification is carried out between primers matching an LTR and a microsatellite domain (SSRs). (c) SSAP. Amplification is carried out between primers matching an LTR and a restriction site adapter ligated to genomic DNA digested with a restriction enzyme. (d) RBIP. Full sites (containing a retrotransposon) are generally scored by an amplification reaction with an LTR primer and a primer in flanking, single copy DNA. Empty sites are scored by amplification between the left and right flanks of the presumptive integration site.
                           a                                                            b

Figure 2 IRAP gel fingerprints. The figure illustrates the results achieved following agarose gel electrophoresis with correct (a) and incorrect (b) conditions. (a) Standard amplification, almost all DNA samples at the same concentration (b) PCR over-amplification, resulting from a too high primer concentration, too many cycles, too much template or loaded sample, or a combination thereof.

                           a                                                                                                b

 Figure 3 IRAP gel fingerprints. The figure shows how to increase the resolution and number of scorable bands by running agarose gel electrophoresis for both short and long periods of time. (a) 10 hours electrophoresis at 80V in a 1.7% agarose gel (b) the samples and gel matrix as in (a), but electrophoresed for 20 hours at 70V.