Di-leucine-mutated 5-HT_1AR is localized in the ER

Flag-tagged 5-HT_1AR as well as I414/415A and C417/420S mutants were used to transfect COS-7 (Fig. 2A,C) or LLC-PK1 (Fig. 2C) cell lines or primary cultures of hippocampal neurons (Fig. 2B,C). Surface labeling was performed by incubating living cells with monoclonal mouse anti-Flag M2 antibody. Transfected cells were then fixed and permeabilized for the subsequent detection of the intracellular receptors using polyclonal rabbit anti-Flag antibody.

As expected, 5-HT_1AR was mostly found at the plasma membrane of each cell type (∼55-65% of surface labeling depending on cell type, Fig. 2C). By contrast, the I414/415A mutant was detected only at low levels at the plasma membrane (∼10-24% of surface labeling), whereas the amounts of C417/420S mutant at the plasma membrane were very close to those of the wild-type 5-HT_1AR.

Intracellular staining of di-leucine-mutated-5-HT_1AR was distributed in perinuclear ER-like structures. Moreover, in transfected COS-7 cells, we observed a strong co-localization of this I414/415A mutant with the ER luminal marker calregulin but not with the cis and median Golgi marker giantin (Fig. 3A). For these co-localization experiments, cells were treated with the protein synthesis inhibitor cycloheximide before fixation, to lower as much as possible the presence of newly synthesized receptors in ER or Golgi apparatus. Under these conditions, wild-type and C417/420S 5-HT_1AR did not co-localize with calregulin and giantin (Fig. 3A). This result indicates that the I414-I415 motif, but not the palmitoylated cysteines, is necessary for 5-HT_1AR exit from the ER.

We also analyzed the glycosylation state of 5-HT_1AR and related mutants. Western blotting of membrane proteins from transfected LLC-PK1 cells showed that both wild-type and C417/420S 5-HT_1AR migrated mainly as a broad band of ∼65 kDa and, to a lesser extent, a thinner band of ∼50 kDa (Fig. 3B). By contrast, the I414/415A mutant migrated only as a band of ∼50 kDa, which suggests that this construction was not correctly glycosylated. We thus treated membranes with endoglycosidase H (Endo H) to remove high-mannose N-glycosylation or peptide N-glycosidase F (PNGase F) to remove both core and complex N-glycosylation. The band observed after treatment with PNGase F should correspond to fully deglycosylated receptors. By contrast Endo H is active only on partially glycosylated proteins. After treatment of wild-type and C417/420S 5-HT_1AR with PNGase F, both 50 kDa and 65 kDa bands shifted to a band of ∼44 kDa, corresponding to the molecular mass calculated for non-glycosylated Flag-tagged 5-HT_1AR. In the case of digestion with Endo H, the broad band of 65 kDa was still visible, confirming that this band corresponded to a fully glycosylated receptor. Only the thin 50 kDa band (partially glycosylated) was eliminated and converted to the ∼44 kDa band. These results showed that the majority of wild-type and C417/420S 5-HT_1AR was completely glycosylated. Concerning the I414/415A mutant, both treatments with Endo H and PNGase F converted the ∼50 kDa band into the ∼44 kDa band, suggesting that this mutant was only partially glycosylated (core glycosylated). These data are consistent with ER retention of the latter mutant, as complex glycosylation occurs only in the Golgi apparatus (Kornfeld and Kornfeld, 1985).

• Download figure
• Open in new tab
• Download powerpoint

Fig. 1.

Cytoplasmic C-terminal domains of 5-HT_1AR and 5-HT_1BR contain a dileucine motif and palmitoylated cysteines. For both receptors, the C-terminal tail amino acid sequence is indicated, with the residues of interest in bold italics.

• Download figure
• Open in new tab
• Download powerpoint

Fig. 2.

Relative surface labeling of 5-HT_1AR and related mutants in transfected COS-7 cells, LLC-PK1 cells and hippocampal neurons. Transfection of COS-7 cells (A) and hippocampal neurons (B) with Flag-5-HT_1A (wild-type), Flag-I414/415A-5-HT_1A or Flag-C417/420S-5-HT_1A. Surface staining with mouse monoclonal anti-Flag M2 antibody and intracellular labeling with rabbit anti-Flag after plasma membrane permeabilization are shown. Bars, 10 μm. (C) Quantification of the percentage of surface labeling of each construct in transfected COS-7 cells, LLC-PK1 cells and neurons. Data are expressed as mean relative surface labeling ± s.e.m. of 10-15 transfected cells per construct. ***P<0.001, when compared with levels in the wild type.

The di-leucine motif is necessary for ligand-binding capacity of 5-HT_1AR

We compared the ligand binding capacity of 5-HT_1AR and mutants using the mixed 5-HT_1A-5-HT_1B agonist radioligand, [³H]LSD (Darmon et al., 1998). Membranes of LLC-PK1 cells transfected with wild-type or C417/420S-5-HT_1AR specifically bound equivalent amounts of tritium after incubation with 1.6 nM [³H]LSD (∼1 pmol/mg of protein, depending on transfection efficiency). By contrast, membranes of cells transfected with I414/415A mutant specifically bound only a very low amount of the radioligand (Fig. 4A).

• Download figure
• Open in new tab
• Download powerpoint

Fig. 3.

Substitution of the dileucine motif of 5-HT_1AR results in ER sequestration. (A) Transfection of COS-7 cells with Flag-5-HT_1A (wild type), Flag-I414/415A-5-HT_1A or Flag-C417/420S-5-HT_1A. Cells were permeabilized and anti-Flag labeling is shown in green and anti-calregulin or anti-giantin labeling is shown in red. Bar, 10 μm. (B) Glycosylation state of receptors was analyzed by western blotting of crude membranes from transfected COS-7 cells with anti-5-HT_1A polyclonal antibody. Membranes were treated with Endo H, PNGaseF or untreated. Similar results were obtained in three independent experiments.

Interestingly, deglycosylation of wild-type 5-HT_1AR with PNGase F did not affect its binding capacity under the same assay conditions (not shown). Thus, the reduced [³H]LSD binding capacity of the I414/415A mutant was very probably not caused by its incomplete glycosylation state. Because ligand binding requires correct folding, it can be inferred that the I414-I415 motif is necessary for correct folding of 5-HT_1AR.

Role of the dileucine motif and palmitoylated cysteines in 5-HT_1AR coupling to G proteins

We first analyzed the interaction of I414/415A and C417/420S 5-HT_1AR with α subunits of G proteins. As illustrated in Fig. 4B, 5-CT-stimulated [³⁵S]GTPγS binding onto membranes from LLC-PK1 cells did not statistically differ whether cells were transfected with wild-type or C417/420S 5-HT_1AR. However, this binding was significantly impaired in the case of membranes transfected with I414/415A mutant.

Furthermore, it was shown that 5-HT_1ARs also interact with G protein βγ subunits to modulate the activity of ERK1/2 (Garnovskaya et al., 1996). We thus tested the ability of 5-HT_1AR and related mutants to activate ERK in transfected LLC-PK1 cells. After treatment with the agonist 8-OH-DPAT for 5 minutes, a ∼sixfold increase in ERK2 phosphorylation was observed in cells expressing wild-type or C417/420S 5-HT_1AR (Fig. 4C,D). These results demonstrate that wild-type and C417/420S 5-HT_1AR activate ERK in our experimental conditions. By contrast, 8-OH-DPAT treatment of cells transfected with I414/415A mutant only induced a ∼2.7-fold increase in ERK phosphorylation.

Mutations in the C-terminus of 5-HT_1BR have only minor effects on its subcellular localization

The percentages of 5-HT_1BR and related mutants at the plasma membrane were also examined. In COS-7 (Fig. 5A,C) and LLC-PK1 cells (Fig. 5C), wild-type 5-HT_1BR displayed a lower level of surface staining than 5-HT_1AR (COS-7, 22.7±2.7%; LLC-PK1, 30.7±6.0%; P<0.001 compared with data in Fig. 2C for 5-HT_1AR). However, this difference between 5-HT_1AR and 5-HT_1BR did not reach statistical significance in neurons. Replacement of the di-leucine motif in the C-terminus of 5-HT_1BR by alanines (LI379/380A) significantly reduced its amount at the plasma membrane in LLC-PK1 cells but not in COS-7 cells and neurons (Fig. 5A-C).

As observed in the case of 5-HT_1AR (Fig. 2C), mutation of the palmitoylated cysteine into a serine (C384S) had no significant effect on the subcellular localization of 5-HT_1BR in all cell types analyzed (Fig. 5A-C).

1ActB chimera reveals the role of the 5-HT_1BR di-leucine motif

In a previous study, we substituted the cytosolic tail of 5-HT_1BR into the 5-HT_1AR and vice versa (Jolimay et al., 2000). Analysis of these chimeras expressed in LLC-PK1 cells and in neurons showed that an apical/axonal targeting signal is located in the C-terminus of 5-HT_1BR. The resulting chimeric receptors, 1ActB (5-HT_1AR with C terminus of 5-HT_1BR) and 1BctA (5-HT_1BR with the C-terminus of 5-HT_1AR), were tagged with the Flag epitope and mutants were constructed for both.

• Download figure
• Open in new tab
• Download powerpoint

Fig. 4.

Roles of dileucine motif and palmitoylated cysteines in 5-HT_1AR binding capacity and coupling. (A) Specific binding of [³H]LSD (1.6 nM) to Flag-5-HT_1A (wild-type), Flag-I414/415A-5-HT_1A or Flag-C417/420S-5-HT_1A receptors in membranes from transfected LLC-PK1 cells. Specific binding, corrected according to transfection efficiency, is expressed as a percentage of the wild-type value. Each bar is the mean ± s.e.m. of three independent determinations performed in triplicate. (B) 5-CT-stimulated [³⁵S]GTPγS binding to membranes from LLC-PK1 cells transfected with Flag-5-HT_1A (wild-type), Flag-I414/415A-5-HT_1A or Flag-C417/420S-5-HT_1A. Basal binding determined in the absence of 5-CT (set to 100%) did not differ from non-specific binding determined in the presence of both 5-CT and WAY 100,635 (1 μM). Each bar is the mean ± s.e.m. of three independent experiments performed in triplicate. (C,D) 8-OH-DPAT-stimulated increase of ERK phosphorylation in LLC-PK1 cells transfected with Flag-5-HT_1A (wild-type), Flag-I414/415A-5-HT_1A or Flag-C417/420S-5-HT_1A. Basal phosphorylation was determined in the absence of ligand. Equal amounts of cell lysate were separated by SDS-PAGE, blotted and revealed with anti-ERK or anti-PERK antibody (C). PERK2 and ERK2 signals were quantified and ERK phosphorylation is expressed as fold increase over basal levels after normalization with total ERK2 signal (D). ERK phosphorylation in stimulated untransfected (LLC-PK1) cells did not differ from the basal signal. Each bar is the mean ± s.e.m. of three independent experiments. *P<0.05 and ***P<0.001, when compared with the wild type; ns, not significant.

In transient transfection experiments, the 1BctA chimera showed a mostly intracellular localization (Fig. 6A,C), and the same observation was made for di-leucine-mutated-1BctA (I379/380A) and for cysteine-mutated-1BctA (C382/385S) in all cell types examined.

On the other hand, 1ActB chimera was mostly localized at the plasma membrane (Fig. 6D-F), like the 5-HT_1AR (Fig. 2). Di-leucine mutation of the chimera (LI414/415A) resulted in a very low level of plasma membrane localization. By contrast, the amounts of C419S-1ActB mutant at the plasma membrane were very close to those of non-mutated 1ActB (Fig. 6D-F).

Role of the di-leucine motif of 5-HT_1AR and 5-HT_1BR

In GPCRs, di-leucine motifs localized mainly in the C-terminal cytosolic tail were found to be important for targeting. Some of these motifs were shown to act as clathrin-dependent endocytosis signals (Fan et al., 2001; Gabilondo et al., 1997; Gaudreau et al., 2004; Orsini et al., 1999). In addition, a role in receptor transport from the ER to the plasma membrane was found for a di-leucine motif with an upstream acidic residue in the case of vasopressin V₂ receptor (Schülein et al., 1998) and, more recently, for a di-leucine motif associated with an upstream phenylalanine residue in the case of α_2B-adrenergic and angiotensin II type 1A receptors (Duvernay et al., 2004) or surrounded by three hydrophobic residues in the case of vasopressin V₃ receptor (Robert et al., 2005). Our results concerning the I414-I415 motif in the C-terminal tail of 5-HT_1AR are consistent with these previous findings. Indeed, replacement of this motif by two alanines resulted in a 5-HT_1AR mutant sequestrated within the ER. The loss of [³H]LSD binding capacity of this mutant (29% of wild-type binding) suggests that such sequestration might be caused by an incorrect folding. However, this binding assay was performed with purified membranes of cells expressing the receptors and does not allow distinction of functional characteristics of plasma membrane versus intracellular receptors because ligand could access both pools of receptors. By contrast, for ERK phosphorylation assays, the ligand 8-OH-DPAT was added to living cells, and only plasma-membrane-localized receptors could thus be activated in this protocol. Interestingly, 8-OH-DPAT-induced activation of ERK phosphorylation in cells transfected with I414/415A mutant was still ∼2.7-fold over basal levels, corresponding to ∼45% of the increase observed for the wild-type receptor. We therefore propose that the observed decrease in ERK activation is most probably due to intracellular sequestration of a large amount of this mutant and that the residual plasma-membrane-localized I414/415A 5-HT_1ARs are functional. This would support the idea of an incorrect folding of sequestrated mutants, as receptors that can exit the ER and reach the plasma membrane seem to be functional, implying their correct folding. However, we cannot entirely exclude that the di-leucine motif of 5-HT_1AR may also participate in receptor ER exit by interaction with COP-II-associated proteins (for a review, see Barlowe, 2003), and that defective interactions caused by the mutation were actually responsible for ER sequestration of the I414/415A mutant.

• Download figure
• Open in new tab
• Download powerpoint

Fig. 5.

Relative surface labeling of 5-HT_1BR and related mutants in transfected COS-7, LLC-PK1 cells and hippocampal neurons. Transfection of COS-7 cells (A) and hippocampal neurons (B) with Flag-5-HT_1B (wild type), Flag-LI379/380A-5-HT_1B or Flag-C384S-5-HT_1B. Surface staining with mouse monoclonal anti-Flag M2 antibody and intracellular labeling with rabbit anti-Flag after plasma membrane permeabilization are shown. Bars, 10 μm. (C) Quantification of the percentage of surface labeling of each construct in transfected COS-7 cells, LLC-PK1 cells and neurons. Data are expressed as mean relative surface labeling ± s.e.m. of 10-15 transfected cells per construct. **P<0.01, when compared with levels in the wild-type.

As noted by Schülein et al. (Schülein et al., 1998) and Duvernay et al. (Duvernay et al., 2004), this di-leucine motif is highly conserved in the C-terminal tail of GPCRs, suggesting a general role in the exit from ER for most of these membrane proteins. However, in our study, replacement of the di-leucine motif by two alanines in the C-terminal tail of 5-HT_1BR only affected its subcellular localization in LLC-PK1 cells, as this mutant did not differ from the wild-type 5-HT_1BR regarding its targeting to the plasma membrane in both COS-7 cells and hippocampal neurons. This apparent discrepancy is not unique among GPCRs. Indeed, mutation of the two conserved leucines in the β₂-adrenergic receptor, which strongly diminished receptor endocytosis, did not affect its targeting to the plasma membrane and its capacity to bind specific ligands (Gabilondo et al., 1997). Therefore, the implication of the two leucines (or isoleucines) localized in the cytosolic C-terminal tail of GPCRs in the exit of the receptor from the ER may not be universal, but would depend on its environment or be associated with other signals. Concerning the 5-HT_1BR, its predominant intracellular localization found in most cell types tested could also explain why substitution of the di-leucine motif did not generally produce further detectable intracellular sequestration.

To further address this question, we constructed chimeras in which the C-terminal domains of 5-HT_1AR and 5-HT_1BR were switched (Jolimay et al., 2000). In transient transfection experiments, 1BctA chimera (5-HT_1BR core with 5-HT_1AR C-tail) exhibited nearly exclusive perinuclear localization, indicating that this construct is probably not functional. On the other hand, a relatively high proportion (∼50%) of 1ActB chimera was localized at the plasma membrane (Fig. 5F), like that observed with the wild-type 5-HT_1AR (Fig. 2C). Accordingly, it can be inferred that the di-leucine motif of the C-terminal domain of 5-HT_1BR allows correct folding of this 1ActB chimera and its exit from ER. This would suggest the need for another signal localized in a different domain of the receptor in addition to the di-leucine motif of the C-terminal tail, which would be present in the 5-HT_1AR but not in the 5-HT_1BR, thereby leading to plasma membrane targeting of the 1ActB but not the 1BctA chimera. Alternatively, it is possible that the high intracellular repartition of transfected 5-HT_1BR masks the actual role of its di-leucine motif.

• Download figure
• Open in new tab
• Download powerpoint

Fig. 6.

Relative surface labeling of 1BctA and 1ActB chimeras and related mutants in transfected COS-7 cells, LLC-PK1 cells and hippocampal neurons. Transfection of COS-7 cells (A) and hippocampal neurons (B) with Flag-1BctA (wild type), Flag-I379/380A-1BctA or Flag-C382/385S-1BctA. Surface staining with mouse monoclonal anti-Flag M2 antibody and intracellular labeling with rabbit anti-Flag after plasma membrane permeabilization are shown. Bars, 10 μm. (C) Quantification of the percentage of surface labeling of each construct in transfected COS-7 cells, LLC-PK1 cells and neurons. Data are expressed as mean relative surface labeling ± s.e.m. of 10-15 transfected cells per construct. No significant differences were noted between the two mutants and the wild-type 1BctA chimera. Transfection of COS-7 cells (D) and hippocampal neurons (E) with Flag-1ActB (wild type), Flag-LI414/415A-1ActB or Flag-C419S-1ActB. Bars, 10 μm. (F) Quantification of the percentage of surface labeling of each construct in transfected COS-7 cells, LLC-PK1 cells and neurons. Data are expressed as mean relative surface labeling ± s.e.m. of 10-15 transfected cells per construct. ***P<0.001, when compared with levels in the wild type.

Role of palmitoylated cysteines

5-HT_1AR and 5-HT_1BR were shown to contain palmitoylated cysteines in their C-terminal domain (Ng et al., 1993; Papoucheva et al., 2004). Substitution of these residues with serines did not affect the subcellular localization of either receptors or chimeras. Furthermore, we found that the glycosylation state and the ligand-binding capacity of 5-HT_1AR were not dependent on the presence of the palmitoylated cysteines. These data are consistent with results obtained by Papoucheva et al. (Papoucheva et al., 2004) who recently demonstrated the constitutive palmitoylation of cysteines 417 and 420 of this receptor. These authors also showed that palmitoylated cysteines 417 and 420 are necessary for the receptor coupling to G_αi3 subunit in transfected insect Sf.9 cells, as well as for its capacity to inhibit adenylyl cyclase activity in NIH3T3 cells and to activate ERK in CHO cells. By contrast, using [³⁵S]GTPγS binding and ERK activation assays, we showed here that the mutation of both palmitoylated cysteines 417 and 420 did not significantly affect 5-HT_1AR coupling with G_α proteins and activation of ERK in LLC-PK1 cells. Such discrepancies might be explained by the use of different cell lines expressing different G_αi subunits and other signaling molecules, in our studies compared with those of Papoucheva et al. (Papoucheva et al., 2004). First, in Sf.9 cells, the G_αi3 subunit was cotransfected with receptors. In LLC-PK1 cells, both G_αi2 and G_αi3 subunits are endogenously expressed but exhibit different subcellular compartmentations: G_αi2 is localized at the basolateral membrane, whereas G_αi3 is restricted to the Golgi apparatus (Ercolani et al., 1990). As we found that 5-HT_1AR is mainly localized at the plasma membrane (Fig. 2), it should interact primarily with G_αi2 in LLC-PK1 cells. Thus, [³⁵S]GTPγS binding results agreed with the hypothesis that the palmitoylated cysteines 417 and 420 are necessary for 5-HT_1AR coupling with the G_αi3 but not the G_αi2 subunit. In the case of ERK phosphorylation, the differences between cell lines tested is less clear, because CHO cells express both G_αi2 and G_αi3 subunits. However, multiple signaling pathways can lead to the activation of ERK after stimulation of a particular GPCR, and some of these pathways may be activated independently of G proteins (for a review, see Werry et al., 2005). In the case of the 5-HT_1AR, the intracellular signaling pathway leading to ERK activation has been shown to implicate G_βγ subunits in CHO cells (Garnovskaya et al., 1996; Della Rocca et al., 1999). However, to date, it is not known whether the same pathway is involved in other cell lines, such as LLC-PK1 cells. It would thus be of interest to identify which intracellular signaling molecules contribute to ERK activation by 8-OH-DPAT in LLC-PK1 cells. In any case, these results suggest that palmitoylated cysteines play variable roles in 5-HT_1AR functional characteristics, depending on the cell type and the signaling molecules available. Such differences were already reported for other GPCRs. Thus, substitution of palmitoylated cysteines by alanines in the A subtype of the endothelin receptor (ET_AR) has been shown to reduce its capacity to activate G_i and G_q proteins without affecting its capacity to activate G_o protein (Doi et al., 1999).

In conclusion, our data show that the di-leucine motif in the C-terminal domain of 5-HT_1A and 5-HT_1B receptors is necessary for their ER sorting through its implication in the proper folding of receptors. They also provide further support for the statement that 5-HT_1A and 5-HT_1B receptors are routed through distinct intracellular pathways towards their final targeting in neurons.

Antibodies

Anti-rat 5-HT_1AR antibody has been described previously (El Mestikawy et al., 1990; Kia et al., 1996; Riad et al., 2000). This polyclonal rabbit antibody is directed against a peptide sequence located within the third intracellular domain of the receptor. Mouse anti-Flag M2 monoclonal antibody, rabbit anti-Flag polyclonal antibody and mouse monoclonal anti-diphosphorylated-ERK1/2 (PERK) were purchased from Sigma (St Louis, MO). Rabbit polyclonal anti-ERK1/2 (ERK) was purchased from Upstate Biotechnology (Charlottesville, VA). Rabbit polyclonal anti-calregulin antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA) and rabbit polyclonal anti-giantin antibody from CRP (Berkeley, CA).

DNA constructs

The complete coding sequences of 1ActB and 1BctA chimeras (Jolimay et al., 2000), rat 5-HT_1AR (Albert et al., 1990) and rat 5-HT_1BR (Hamblin et al., 1992) were subcloned into pFlag-CMV-6c expression vector (Sigma) to obtain constructs tagged with Flag at their N-termini. Receptor mutants were generated using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). Only the sense oligonucleotides are listed below, with the mutated nucleotides in bold letters. Oligo 5-HT_1A, I414/415A: CGCTTTTAAGAAGGCAGCCAAGTGCAAGTTCTGCCG, for di-leucine motif substitution by alanines within 5-HT_1AR and 1BctA chimera; Oligo 5-HT_1B, LI379/380A: CAAGCATTCCATAAAGCGGCACGCTTTAAGTGCACAGG, for di-leucine motif substitution by alanines within 5-HT_1BR and 1ActB chimera; Oligo 5-HT_1A, C417/420S: AAGATAATCAAGAGCAAGTTCAGCCGCCGATGAGAATTC, for cysteines substitution by serines within 5-HT_1AR and 1BctA chimera; Oligo 5-HT_1B, C384S: CTGATACGCTTTAAGAGCACAGGTTGAGAATTCAGATC, for cysteine substitution by serine within 5-HT_1BR and 1ActB chimera. All constructions were confirmed by sequencing the complete coding sequence.

Cell cultures

LLC-PK1 cells were grown in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 4.5 g/l glucose, GlutaMAX I (Invitrogen, Cergy Pontoise, France), 10% fetal bovine serum, 10 U/ml penicillin G and 10 g/ml streptomycin. COS-7 cells were grown in DMEM supplemented with 1 g/l glucose, 10% fetal bovine serum, 2 mM L-glutamine, 10 U/ml penicillin G and 10 mg/ml streptomycin.

Neuronal cultures were made as described previously (Goslin et al., 1998) with some modifications. Hippocampi of rat embryos were dissected at day 17-18. After trypsinization, tissue dissociation was achieved with a Pasteur pipette. Cells were counted and plated on poly-L-lysine-coated 12-mm-diameter coverslips, at a density of 60,000-75,000 cells per 16-mm dish (300-375 cells per square millimeter), in complete Neurobasal medium supplemented with B27 (Invitrogen), containing 0.5 mM L-glutamine, 10 U/ml penicillin G, and 10 mg/ml streptomycin. Five hours after plating, the coverslips were transferred to a 90-mm dish containing conditioned medium obtained by incubating glial cultures (70-80% confluency) for 24 hours in the complete medium described above. Experiments were performed in agreement with the institutional guidelines for use of animals and their care, in compliance with national and international laws and policies (Council directives no. 87-848, October 19, 1987, Ministère de l'Agriculture et de la Forêt, Service Vétérinaire de la Santé et de la Protection Animale, permissions nos. 75-116 to M.H. and 75-974 to M.D.)

Cell transfections

For immunofluorescence experiments, LLC-PK1 and COS-7 cells were transferred to 12-mm-diameter coverslips 16 hours before transfection to obtain 30-50% confluency cultures. LLC-PK1 cells were transfected using Lipofectin reagent (Invitrogen). For each coverslip, 1 μg plasmid DNA and 1-3 μl Lipofectin were both diluted separately in 125 μl serum-free DMEM. After a 30-45 minute incubation at room temperature, the two dilutions were combined and the resulting mix was left for another 10-15 minutes at room temperature. Cells were washed with 500 μl serum-free DMEM and mix was added for an overnight incubation at 37°C.

COS-7 cells were transfected using FuGENE reagent (Roche, Meylan, France). For each coverslip, 2 μl FuGENE were diluted in 50 μl D-PBS (Dulbecco's phosphate-buffered saline, Invitrogen) and incubated for 5 minutes at room temperature. The dilution was then mixed with 1 μg plasmid DNA, and incubation proceeded for another 15 minutes. This mix was added to the growth medium (250 μl) overlaying the cells and transfection lasted 24 hours at 37°C.

Hippocampal neurons were transfected on the 7-8th day in vitro as follows: for each coverslip, plasmid DNA (0.8 μg) was mixed with 50 μl Neurobasal medium without B27 supplement. After 15 minutes at room temperature, 0.8 μl Lipofectamine 2000 (Invitrogen) in 50 μl Neurobasal medium were added and incubation continued for another 20 minutes. After the addition of 150 μl of complete Neurobasal medium containing B27 supplement, the mix was applied onto the neuronal culture, and transfection lasted for 3 hours at 37°C. Typically, 5-10% of neurons expressed the receptors after transfection.

For both cell lines and hippocampal neurons, receptor expression was allowed in growth medium for 24 hours after transfection.

For preparation of membranes and ERK phosphorylation assays (see below), LLC-PK1 cells were transfected by electroporation using Gene Pulser Xcell electroporation system (Bio-Rad, Hercules, CA; 135 V, 1800 μF in 200 μl DMEM containing 5-10×10⁶ cells and 5-10 μg plasmid DNA; relaxation time: ∼40 milliseconds). Cells were then transferred to a 90-mm dish and grown for 3 days in LLC-PK1 growth medium.

Indirect immunofluorescence

Cells on coverslips were washed with D-PBS+ (D-PBS containing 0.1 mM CaCl₂ and 0.1 mM MgCl₂) at 37°C, then fixed with paraformaldehyde (3%) containing 4% sucrose at 37°C in D-PBS+, and permeabilized with 0.1% Triton X-100 in D-PBS+. After two 10-minute washes in D-PBS+, cells were incubated for 30 minutes in antibody buffer (3% bovine serum albumin, 2% normal goat serum, 2% normal donkey serum in D-PBS+). Incubation with primary antibodies was then performed in antibody buffer for 1 hour at room temperature. After two 10-minute washes in D-PBS+, incubation with secondary antibodies proceeded for 1 hour. The secondary antibodies used were Cy3-conjugated donkey anti-rabbit IgG (1:1600 dilution; Jackson ImmunoResearch, West Grove, PA), and Alexa Fluor 488-conjugated goat anti-mouse IgG (1:1600; Molecular Probes, Eugene, OR). The coverslips were finally mounted in Fluoromount-G solution (Clinisciences, Montrouge, France). For ER and Golgi co-localization experiments, cells were treated with the protein synthesis inhibitor cycloheximide (70 μM) for 4 hours before fixation, to lower as much as possible the presence of newly synthesized receptors in ER or Golgi apparatus. ER and Golgi labeling was performed using anti-calregulin antibody (1:100 dilution) and anti-giantin antibody (1:2000 dilution), respectively, and receptors were labeled using anti-Flag M2 monoclonal antibody. For surface detection, anti-Flag M2 antibody (2.5 μg/ml) was incubated with living cells for 20 minutes at room temperature. Cells were washed in D-PBS+, fixed with paraformaldehyde (3%) containing 4% sucrose, and incubated for 1 hour with Alexa Fluor 488-conjugated goat anti-mouse IgG in antibody buffer. After permeabilization with 0.1% Triton X-100 in D-PBS+, intracellular epitopes were detected using rabbit anti-Flag polyclonal antibody (0.85 μg/ml) subsequently revealed by Cy3-conjugated donkey anti-rabbit IgG.

Immunofluorescence images were generated using a Leica laser-scanning confocal microscope. For relative surface label analysis, unsaturated acquisitions were made with the same exposure settings and laser gain for each condition. For each cell type, at least ten cells were analyzed. Quantification of surface and intracellular staining were performed using ImageJ software (NIH) according to Jaskolski et al. (Jaskolski et al., 2004) with modifications, and statistical analysis was carried out using GraphPad Prism 4 (GraphPad Software, San Diego, CA). Background was lowered using Gaussian blur (radius 1 pixel) and an intensity threshold was fixed just above the background level to maximally reduce non-specific staining. Single cells were selected and carefully traced manually. Surface (S) and intracellular (I) areas with labeling above threshold were measured and the percentage of surface receptor labeling calculated as S×100/(S+I).

Contrast and brightness of images displayed in figures were modified using Adobe Photoshop 7.0 (Adobe Systems, San Jose, CA) for clearer demonstration and do not correspond to the analysis conditions.

Preparation of membranes

Transfected LLC-PK1 cells were washed with D-PBS, scraped into Tris buffer (50 mM Tris-HCl, pH 7.4), and homogenized with a Polytron. After each of four successive washings in Tris buffer, the membranes were collected by centrifugation at 31,000 g for 20 minutes at 4°C. An incubation for 10 minutes at 37°C was performed after the first washing to eliminate 5-HT (from the serum in the culture medium), and the final pellet was suspended in the same Tris buffer to be stored at –80°C until use. Protein concentration was measured using BCA protein assay kit (Pierce, Rockford, IL).

Deglycosylation

For deglycosylation assays, membranes were first denaturated by incubation for 10 minutes at 100°C in 0.5% (w/v) SDS, 1% (v/v) β-mercaptoethanol. Membranes (40 μg of protein) were then incubated with or without 500 U Endo H or PNGase F (Ozyme, Saint-Quentin Fallavier, France) for 1 hour at 37°C, according to supplier's recommendations. Proteins were separated by electrophoresis, transferred to nitrocellulose, and probed with anti-5-HT_1AR antibody (1:1000 dilution). After incubation with anti-rabbit antibodies coupled to horseradish peroxidase (Sigma, 1:10,000 dilution), bands were detected with the ECL+ kit (Amersham Biosciences, Amersham, UK). The band corresponding to PNGase-F-deglycosylated receptors (total amount of receptors) was quantified using a Fuji FLA 2000 Phosphoimager (Raytest, Courbevoie, France) and analyzed using Aida (Raytest).

For membranes subsequently used for binding assays, deglycosylation was done without denaturation.

Radioligand binding assays

Binding assays were performed using 20-25 μg membrane proteins in 500 μl of 50 mM Tris-HCl buffer, pH 7.4, supplemented with 1.6 nM [³H]lysergic acid diethylamide ([³H]LSD; 79.2 Ci/mmol; Amersham Biosciences). Incubations were performed for 90 minutes at 25°C. Non-specific binding was determined in the presence of 10 μM 5-HT. Assays were stopped by rapid filtration through Whatman GF/B filters coated with polyethylenimine (0.5% v/v). Subsequent washing and counting of entrapped radioactivity were as described by Fabre et al. (Fabre et al., 1997). Specific binding is expressed as a percentage of wild-type receptor specific binding. Data were corrected for individual variations in transfection efficiency by relative quantification of receptors as detailed in the deglycosylation procedures. Data analysis was done using GraphPad Prism 4.

[³⁵S]GTP-γ-S binding assays

Binding of [³⁵S]GTPγS onto transiently transfected LLC-PK1 cell membranes stimulated by 5-carboxamido-tryptamine maleate (5-CT; Sigma) was measured according to a procedure adapted from Alper and Nelson (Alper and Nelson, 1998) and Fabre et al. (Fabre et al., 2000). Briefly, membranes (∼40-50 μg protein) were incubated for 30 minutes at 37°C in a final volume of 800 μl assay buffer (50 mM Tris-HCl, 3 mM MgCl₂, 120 mM NaCl, 0.2 mM EGTA) containing 0.1 nM [³⁵S]GTPγS (1000 Ci/mmol, Amersham Biosciences), 300 μM GDP and 1 μM 5-CT. The reaction was terminated by addition of 3 ml ice-cold 50 mM Tris buffer and rapid vacuum filtration through Whatman GF/B filters. Each filter was then washed twice with 3 ml ice-cold Tris buffer, placed into 4.5 ml scintillation fluid and its entrapped radioactivity measured. Basal [³⁵S]GTPγS binding was determined from samples without 5-CT, and non specific binding from those supplemented with both 5-CT and WAY 100,635 (1 μM), a selective 5-HT_1AR antagonist (Fabre et al., 2000).

ERK phosphorylation assays

Electroporated LLC-PK1 cells were transferred to 35-mm dishes 24 hours after transfection and grown for another 10 hours in LLC-PK1 growth medium. Cells were then starved for at least 8 hours in serum-free medium and subsequently treated with 1 μM 8-OH-DPAT (8-hydroxy-N,N-dipropyl-2-amino-tetralin, Sigma) for 5 minutes at 37°C under 5% CO₂. Cells were then washed in ice-cold D-PBS and lysed in 50 μl sodium dodecyl sulphate sample buffer (Laemmli, 1970). For each transfection, an equal portion of the cells was set aside for protein determination with BCA kit. Equal quantities of extracts from cells exposed to 8-OH-DPAT or none (controls) were separated by electrophoresis, transferred to nitrocellulose, and probed with rabbit anti-ERK (1:10,000 dilution) or mouse anti-PERK (1:2500 dilution) antibodies. After incubation with anti-rabbit (1:10,000 dilution, Sigma) or anti-mouse (1:2500 dilution, Sigma) antibodies coupled to horseradish peroxidase, revelation was performed with the ECL+ kit. ERK-2 and PERK2 bands were quantified as described in deglycosylation section. PERK2/ERK2 ratio was calculated for each sample for normalization and data were expressed as the fold increase over basal levels. Data analysis was done using GraphPad Prism 4.

Statistical analyses

For relative surface label analysis, statistical significance was assessed using a one-way ANOVA followed by a Bonferroni test. For [³H]LSD and [³⁵S]GTPγS binding assays as well as for ERK activation assays, differences were evaluated using unpaired and paired Student's t-tests, as appropriate. The significance level was set at P<0.05.